Protein Science Sheba protein
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Weiner, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Weiner, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Protein Science (2001), 10:1490-1497.
Copyright © 2001 The Protein Society

The N-terminal portion of mature aldehyde dehydrogenase affects protein folding and assembly

Jianzhong Zhou and Henry Weiner

Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907-1153, USA

Reprint requests to: Dr. Henry Weiner, Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907-1153, USA; e-mail: hweiner{at}purdue.edu; fax: (765) 494-7897.

(RECEIVED February 7, 2001; FINAL REVISION April 19, 2001; ACCEPTED April 26, 2001)

Article and publication are at http://www.proteinscience.org/cgi/doi/10.1101/ps.5301.


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Human liver cytosolic (ALDH1) and mitochondrial (ALDH2) aldehyde dehydrogenases are both encoded in the nucleus and synthesized in the cytosol. ALDH1 must fold in the cytosol, but ALDH2 is first synthesized as a precursor and must remain unfolded during import into mitochondria. The two mature forms share high identity (68%) at the protein sequence level except for the first 21 residues (14%); their tertiary structures were found to be essentially identical. ALDH1 folded faster in vitro than ALDH2 and could assemble to tetramers while ALDH2 remained as monomers. Import assay was used as a tool to study the folding status of ALDH1 and ALDH2. pALDH1 was made by fusing the presequence of precursor ALDH2 to the N-terminal end of ALDH1. Its import was reduced about 10-fold compared to the precursor ALDH2. The exchange of the N-terminal 21 residues from the mature portion altered import, folding, and assembly of precursor ALDH1 and precursor ALDH2. More of chimeric ALDH1 precursor was imported into mitochondria compared to its parent precursor ALDH1. The import of chimeric ALDH2 precursor, the counterpart of chimeric ALDH1 precursor, was reduced compared to its parent precursor ALDH2. Mature ALDH1 proved to be more stable against urea denaturation than ALDH2. Urea unfolding improved the import of precursor ALDH1 and the chimeric precursors but not precursor ALDH2, consistent with ALDH1 and the chimeric ALDHs being more stable than ALDH2. The N-terminal segment of the mature protein, and not the presequence, makes a major contribution to the folding, assembly, and stability of the precursor and may play a role in folding and hence the translocation of the precursor into mitochondria.

Keywords: Aldehyde dehydrogenase; N-terminal portion; chimeric proteins; folding; import into mitochondria

Abbreviations: ALDH, aldehyde dehydrogenase • ALDH2, mitochondrial mature aldehyde dehydrogenase • pALDH2, mitochondrial aldehyde dehydrogenase precursor • ALDH1, cytosolic aldehyde dehydrogenase • pALDH1, the presequence of pALDH2 fused to the ALDH1 • M-ALDH1, chimeric protein of ALDH1 in which the first 21 amino acid residues of the mature protein were replaced by the corresponding residues from ALDH2 • pM-ALDH1, the presequence of pALDH2 fused to M-ALDH1 • C-ALDH2, chimeric protein of ALDH2 in which the first 21 amino acid residues of the mature protein were replaced by the corresponding residues from ALDH1 • pC-ALDH2, the presequence of pALDH2 fused to C-ALDH2 • HEPES, N-(2-hydroxyethyl) piperazine-N'-(2-ethanesulfonic acid) • HEPPS, N-2-hydroxyethylpiperazine-N'-3-propanesulfonic acid • DTT, dithiotreitol • PAGE, polyacrylamide gel electrophoresis • PCR, polymerase chain reaction


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Although it was initially thought that all unfolded proteins could spontaneously fold into their final three-dimensional structure, it is currently accepted that a family of heat shock proteins that function as chaperones helps govern the folding process. An interesting dilemma occurs when one considers a pair of isozymes destined for different final subcellular localizations. This is especially true when one is destined for the mitochondria whereas the other is to remain in the cytoplasm. The mitochondrial protein must be unfolded to be translocated across the mitochondrial membranes, but the cytosolic counterpart becomes folded. How, then, do the chaperones recognize which to fold and which to keep unfolded?

Proteins destined for the mitochondria are synthesized as precursor proteins. The amino acids that direct the protein to be imported into the mitochondria are located at the N-terminal end and are usually removed after import (Schatz 1987). Each precursor has its own unique leader, but, in general, the leaders are typically rich in positive charges and have the ability to form an {alpha} helix (von Heijne 1986; Roise et al. 1988; Karslake et al. 1990; Thornton et al. 1993). The latter has been determined by studying synthetic peptides, because no structure of leader associated with the mature portion of a protein has been determined. It has generally been accepted that the leader sequence functions independently of the mature portion of the precursor, because leaders fused to other proteins were able to cause them to be imported. We, as well as others, have found that this may not be valid in all cases, however, for not every leader can bring every protein into the mitochondria, indicating that the mature portion of a protein does affect import (Emr et al. 1986; Van Steeg et al. 1986; Kimura et al. 1993; Waltner et al. 1996).

Most pairs of isozymes share high sequence and structural homology or identity. For example, human liver cytosolic and mitochondrial aldehyde dehydrogenases have nearly 70% sequence identity (Hempel et al. 1985; Hsu et al. 1985) and have essentially identical three-dimensional structures (Ni et al. 1999). The high sequence identity is not found in the first 21 amino acids. Other pairs of isozymes show the same pattern. The sequences are very similar throughout the entire protein except for the first 25 or so residues. The mitochondrial aspartate aminotransferases and phosphoenolpyruvate carboxykinases differ from their cytosolic counterparts by having an extension of amino acids at the N-terminal end of the mature portion and by having little similarity in the first ~25 residues of the mature protein (Davoodi et al. 1998; Weldon et al. 1990; Mattingly et al. 1993a).

From structures of the mature ALDHs it was found that the first 6–8 residues were invisible but the remaining ones of the first 21 residues were bound to the surface of the subunit, making no contact with the other subunits in the tetramer. We recently reported that there was a critical interaction between just one of these residues and a residue within the mitochondrial enzyme (Ni et al. 1999). Therefore, it appears that these first 21 residues may affect the stability of the entire protein.

Some reports suggest that the leader influences the mature portion of the precursor protein (Mattingly et al. 1993a). We showed with ALDH that the recombinantly expressed precursor protein was both stable and active. The folding rates were not studied, however, and in this paper we report on our investigation to determine whether the leader alone or the first 21 amino acids of the mature portion of the protein affected the folding and stability of ALDH. Because only unfolded proteins can be imported into mitochondria, the ability of the protein to be translocated across the membrane was used as the assay.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Investigation of stability of recombinantly expressed mature aldehyde dehydrogenases
Our previous work showed that when the first 21 amino acid residues of the mature mitochondrial and cytosolic ALDH were exchanged, the chimeric form of ALDH2, C-ALDH2, was insoluble when expressed in Escherichia coli (Ni et al. 1999), but M-ALDH1, a counterpart of C-ALDH2, was found to be soluble and similar to ALDH1 with respect to its kinetic properties. This implied that their stability or folding properties might be different. Their stability, along with that of others shown in Figure 1Go, was investigated by measuring the circular dichroism of the recombinantly expressed proteins in the presence of urea. It was found that ALDH1 was more stable toward urea denaturation than was the mitochondrial isozyme (Fig. 2Go). In fact, the CD spectra for the cytosolic form did not change until the urea concentration was >6 M. In contrast, the mitochondrial enzyme was denatured in <4 M urea. M-ALDH1 was less stable than ALDH1 but still much more stable than ALDH2.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Mature and precursor forms of native and chimeric human liver cytosolic (ALDH1) and mitochondrial (ALDH2) aldehyde dehydrogenase. Alignment of the N-terminal 33 amino acids between mature ALDH1 and ALDH2 is also shown in this figure. The first 21 residues only share 14% identity, whereas the overall identity is ~70%. Amino acid residues in the constructs are indicated. Black, white, and slash boxes represent the presequence, ALDH1 portion, and ALDH2 portion, respectively.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Molar ellipticity of ALDHs at 222 nm as a function of denaturant concentration. Results are expressed as percentage of molar ellipticity as compared to a control carried out in the absence of denaturant. (triangles) ALDH1; (diamonds) ALDH2; (squares) M-ALDH1.

 
The in vitro folding rates of the newly synthesized proteins
To investigate the influence of the mature portion on the folding rate, trypsin digestion of proteins newly synthesized in a TNT-coupled reticulocyte lysate system was performed. ALDH2 is initially synthesized as a precursor in the cell. It had been shown that precursors fold slowly in the reticulocyte lysate (Mattingly et al. 1993a; Waltner and Weiner 1995). Those precursors translated in the reticulocyte lysate at 30°C were initially very susceptible to digestion by trypsin, but with time, they underwent a slow conversion to a trypsin-resistant, presumably folded, state (Mattingly et al. 1993a; Waltner and Weiner 1995). To investigate whether the presequence affects folding, the mature and precursor forms were synthesized in the reticulocyte lysate for 60 min at 30°C and stopped with cycloheximide. The proteins were then allowed to fold at 15°C for various times and then subjected to a 1-, 5-, 10-, or 20-min trypsin digestion, which was terminated by the addition of SDS. The protein remaining after the digestion was quantified (Fig. 3Go). Although each protein became more resistant to trypsin digestion with time, with the resistance varying for the different proteins, when the proteins were subjected to a 5-min trypsin treatment immediately after being synthesized, the protein remaining was about 15% for both mature and precursor ALDH1 forms, but only 1% for either mature or precursor ALDH2. After a 120-min extended incubation at 15°C before trypsin was added, the remaining precursor and mature ALDH1 increased to 25%, whereas the precursor or the mature ALDH2 increased to just 3%. This showed that precursor and mature ALDH1 became more trypsin-resistant than the corresponding ALDH2 isoforms in the reticulocyte lysate. After the extended incubation most of the ALDH2 forms were still susceptible to proteolysis, presumably because they were still unfolded or loosely folded.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Trypsin resistance of ALDHs synthesized in the TNT coupled reticulocyte lysate. Each precursor and mature protein was translated for 60 min at 30°C. An aliquot was then removed and incubated at 15°C for the indicated times. Proteins remaining after a 5-min trypsin digestion were quantified and compared for each time point. Experiments were repeated in duplicate, and the results were averaged.

 
Similar results for trypsin digestion were observed with the chimeras. The protein remaining after a 5-min trypsin digestion was about 8% for both precursor and mature forms of M-ALDH1, whereas, with the precursor and mature forms of C-ALDH2, only 1% remained after the digestion. After a 120-min extended incubation at 15°C before trypsin was added, 18% and 13% of mature and precursor M-ALDH1 were found, whereas 10% and 13% of mature and precursor C-ALDH2 were found, respectively (Fig. 3Go). It appeared that the presence of the presequence did not significantly affect the susceptibility to trypsin digestion when comparing mature forms to their precursor forms. The results showed that the mature N-terminal segment contributed to the folding rate. The N terminus from mature ALDH1 enhanced folding, but that from mature ALDH2 retarded folding.

Protein assembly could be affected by the N-terminal segment of aldehyde dehydrogenase
It was previously shown that rat precursor and mature ALDH2 synthesized in a reticulocyte lysate system were monomers, determined by sucrose gradient ultracentrifugation (Jeng and Weiner 1991). We also found that human precursor and mature ALDH2 remained as monomers when analyzed by sucrose gradient ultracentrifugation (Fig. 4aGo). Unexpectedly, when the same method was used to study ALDH1 and pALDH1 we found some 220-kD tetrameric complexes (Fig. 4aGo).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Assembly of precursor and mature ALDH1, ALDH2, and chimeric ALDHs as determined by sucrose gradient centrifugation. Molecular weights of in vitro-translated proteins were determined by sucrose gradient centrifugation as described in Materials and Methods. The fractions were collected from the bottom of the centrifuge tube after centrifugation. Aliquots from fractions were subjected to 10% SDS-PAGE followed by phosphorimaging. BSA (56 kD) appeared between 9.0 and 9.5 mL as detected by Coomassie Brilliant Blue staining and recombinant ALDH2 (220 kD) was found between 5.5 and 5.8 mL as detected by Western blotting. (A) (diamonds) ALDH1; (squares) ALDH2; (triangles) pALDH1; (crosses) pALDH2. (B) (diamonds) M-ALDH1; (squares) C-ALDH2; (triangles) pM-ALDH1; (crosses) pC-ALDH2.

 
The pM-ALDH1 and M-ALDH1 proteins, like their parent pALDH1 and ALDH1 proteins, can assemble to a tetramerlike complex. However, it was surprising to find that some of either pC-ALDH2 or C-ALDH2 also formed a 220-kD complex (Fig. 4bGo). This indicated that in the in vitro translational system, the N-terminal 21 amino acid residues of mature ALDH2 could prevent the proteins from assembling to a tetrameric enzyme, whereas the N-terminal portion of ALDH1 could enhance the protein's assembly. Both mature and precursor ALDH1 formed tetramers, indicating that the presequence alone did not affect the assembly of the subunits but the first 21 residues of the mature portion did.

It is known that some newly synthesized peptides are associated with hsp70 (Chirico 1992; Hainaut and Milner 1992). In our analysis of the sucrose gradient ultracentrifugation, hsp70 from the reticulocyte lysate was not found with either the monomeric form (55 kD) or the tetramerlike complex of 220 kD (data not shown). The hsp70, detected by using the ECL Western blotting kit, appeared between the 55-kD and 220-kD fractions. It is possible that hsp70 was released because the protein subunit was already folded.

Mature portion affects import of precursor proteins into isolated mitochondria
The four presequence-containing proteins—pALDH1, pALDH2, pM-ALDH1, and pC-ALDH2—synthesized in a TNT-coupled reticulocyte lysate, were imported into isolated yeast mitochondria and specifically processed by the mitochondrial processing peptidase to the mature form (Fig. 5Go). The percent of pALDH2 imported was observed to be much higher than that of pALDH1. About 21% of pALDH2 could be imported, but only 2% of pALDH1 could be (Table 1Go). This indicated that the mature portion affected the import of the precursor into mitochondria even though both mature proteins have an essentially identical tertiary structure. The percentage of protein imported for pM-ALDH1 (10%) increased compared with pALDH1 (2%), whereas it decreased somewhat for pC-ALDH2 (15%) compared with pALDH2 (22%), as shown in Table 1Go. This indicated that the N-terminal segment of mature ALDH2 could increase import whereas that of ALDH1 could decrease import. pALDH1 appeared to be much larger on SDS-PAGE than pALDH2 (Fig. 5Go). Mass spectrometry analysis (data not shown) of E. coli recombinantly expressed proteins revealed that they had identical molecular mass (about 55 kD). The different migrations on SDS-PAGE may be caused by an anomalous interaction of these proteins with SDS (Schofield et al. 1992; Hara et al. 1997; Zhou and Weiner 2000).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. In vitro import of the precursor ALDHs into yeast mitochondria. Each of the precursor proteins was translated in the TNT reticulocyte lysate system (TR) and was incubated with isolated mitochondria for 30 min at 30°C. Half of the reaction was treated with protease K (+PK), and the other half was left untreated (-PK). Imported protein is defined as the protein remaining after the mitochondria were treated with protease K, which destroyed translated proteins that were not imported. Proteins were analyzed using SDS-PAGE and phosphorimaging.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Import of 35[S]-labeled precursors into mitochondria with or without urea unfolding
 
Import in the presence of urea
To further verify that import might be related to the stability of the precursor protein, the import was studied with denatured precursors. It was shown that the unfolding of precursors by preincubation in 8 M urea allowed them to be more rapidly translocated into mitochondria (Kang et al. 1990). If, after being denatured, all ALDH constructs with the same presequence were imported into the mitochondria at a similar level, it would indicate that it was the conformational state that prevented translocation prior to being denatured. The import of denatured pALDH2 into mitochondria was found to be the same as that of the undenatured one, whereas it increased for the pALDH1, pM-ALDH1, and pC-ALDH2. After denaturation, all of them were translocated at the same level as pALDH2 (Table 1Go). This implied that pALDH1 and the two chimeric precursors might have been more tightly folded than was pALDH2 and the urea-induced unfolding increased their import. Because pALDH2 could always be unfolded the presence of urea had no effect on its import.


    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Proteins destined for the mitochondria must be partially unfolded to cross the membrane, whereas a cytosolic protein must fold either while being synthesized or after being released from the ribosome. Each of these events could be governed by the action of a chaperone protein. What governs the folding mechanism of each is not known, although much is known about how the chaperone functions once it binds the target. There appear to be two major sequence differences between the mitochondrial isozyme and its cytoplasmic counterpart. These are the leader sequence of 15–25 amino acids located at the N-terminal end of the mature protein and possibly the first 25 or so residues of the mature protein. The data presented in this study suggest the possibility that the fate of the protein is not determined just by the leader sequence.

Cytosolic and mitochondrial human liver ALDH represent an ideal pair to investigate the importance of the leader and the mature portion of the protein in folding. These proteins are nearly 70% identical except for first 21 residues of the mature portion, which shares just 14% identity. Furthermore, we have already shown that the precursor of mitochondrial ALDH is fully active (Jeng and Weiner 1991) and that the first 21 residues of the mature portion affect the properties of the protein (Ni et al. 1999). Folding was indirectly studied in this paper: The ability of the protein to be imported into mitochondria, an event requiring an unfolded protein, was used to assess whether or not the protein was folded.

We found that even though both the authentic pALDH2 and the artificial pALDH1 could be imported into isolated mitochondria, the import of pALDH1 was 10 times less than that of pALDH2. This indicates that the mature portion of ALDH affected the import of the protein into mitochondria. Less import of the pALDH1 could be related to its being folded faster than pALDH2 in the in vitro translational system and hence becoming less import-competent. It was found (Mattingly et al. 1993a) that cytosolic aspartate aminotransferase and its artificial precursor both fold much more rapidly than did the mature and the intact precursor mitochondrial forms. We found that the resistances of mature and precursor ALDH1 against protease digestion were greater than that of the ALDH2 forms, implying that ALDH1 and pALDH1 folded much faster than did ALDH2 and pALDH2. Some ALDH1 and pALDH1 was also found to be able to assemble into tetrameric complexes. This rapid folding of the mature portion and subsequent assembly could be the reason that the import was impaired.

When we exchanged the mature N-terminal first 21 amino acid residues, which represent the most striking sequence difference between the two ALDH isozymes, import of pM-ALDH1 was greater than its parent pALDH1, and the import of pC-ALDH2 was less than its parent pALDH2. The protease digestion studies with these chimeric proteins indicated that pM-ALDH1 could fold more slowly than pALDH1, whereas pC-ALDH2 folded faster than pALDH2. Like its parent, some of pM-ALDH1 could form the 220-kD complex. Unexpectedly, the 220-kD complex was also found in the pC-ALDH2 sample, indicating that the first 21 residues could affect not only folding but also ultimate assembly into tetramers. These results are consistent with the import of the precursor ALDHs. In another well-studied pair of proteins—mitochondrial and cytosolic forms of aspartate aminotransferase—an analogous relationship between the most N-terminal residues was found. These enzymes are also nearly identical in their three-dimensional structures. They have >50% sequence similarity in amino acid sequence, and the N-terminal segment contains one of the regions of greater dissimilarities. The N-terminal region comprised of amino acids 1–29 in the mature aspartate aminotransferase is thought to be important in maintaining the completely folded protein in a dimeric structure (Sandmeier and Christen 1980) and is known to be critical for stability (Lain et al. 1998). Assembly might have occurred simply because more folded monomers were present.

The presequence seemed to have almost no role in determining the folding rate of these proteins, at least as measured by trypsin digestion. The leader must not affect the overall protein for some precursor proteins, such as rat mitochondrial aspartate aminotransferase (Altieri et al. 1989), ornithine carbamoyltransferase (Murakami et al. 1990), and ALDH (Jeng and Weiner 1991), because these were found to possess catalytic activity, indicating that the presequences did not prevent the folding of the mature portions. The protease digestion studies show that the leader sequence did not affect the rate of proteolysis of the protein. It therfore appears that the presence of the leader does not greatly affect the mature portion.

Our previous work showed that the first 21 amino acids of the mature portion of ALDH affected the solubility of the proteins (Ni et al. 1999). The in vitro stability data presented here show that their stability against urea denaturation greatly differed. The cytosolic form was extremely stable against the loss of secondary structure in concentrations as high as 7 M urea, whereas the mitochondrial form lost its structure in the presence of <4 M urea. Although we are unable to offer a physical explanation for why the mitochondrial ALDH isozyme is more easily unfolded, it is possible that it might be related to the inherent need for a single subunit of the mitochondrial isozyme to be unfolded during its translocation across the mitochondrial membranes. This unfolding is necessary because precursor proteins are not transported into mitochondria in a tightly folded state (Eilers and Schatz 1986; Chen and Douglas 1987).

Support for the idea that it is the N-terminal residues of the mature protein that affect stability and folding comes from the data obtained with the chimeric ALDHs. Exchanging the first 21 amino acid residues of ALDH2 for those of ALDH1 produced a protein with less stability. Import in the presence of urea supports the hypothesis that the 21 residues of the mature portion affect the protein's ability to fold. If the tightly folded conformation of ALDH resulted in the reduced import of protein into mitochondria, unfolding the precursor by urea would increase import. The urea unfolding allowed increased translocation of pALDH1, pM-ALDH1, and pC-ALDH2 but not pALDH2 into isolated yeast mitochondria. The more stable the protein is, the larger the increase will be when urea is present. Even though the translocation of pALDH1, pM-ALDH1, and pC-ALDH2 was increased, translocation could only reach the level of that of pALDH2, whose import did not change under the unfolding condition. It is not clear yet why the denaturation cannot increase the import of pALDH2. This could be owing to a dual effect of urea on import. Urea could improve import by unfolding the mature portion of the precursor. At the same time, urea might inhibit import by destroying the structure of the presequence in which an amphiphilic {alpha}-helix structure is essential for import (Wang and Weiner 1993). It may be a common feature that in a pair of mitochondrial and cytosolic proteins the cytosolic form folds faster and is more stable than is the mitochondrial counterpart (Mattingly et al. 1993a; Lain et al. 1995).

The results presented in this study clearly indicate that folding, assembly, and stability of the precursor and mature proteins are influenced by the N-terminal portion of the mature region and not just the presequence. Additional investigation of the interaction of the N-terminal segment of a protein with heat shock proteins will have to be undertaken before it is known whether or not it is the important initial site of contact in the chaperone-assisted folding of proteins. It is possible that the mitochondrial import apparatus could be involved in unfolding of the precursor protein. If this is the case, then the N-terminal residues of the mature part could be involved in this recognition.


    Materials and methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Construction of chimeric proteins
The various constructs used in these studies are illustrated in Figure 1Go. cDNA encoding human liver mitochondrial precursor ALDH2 was from David Crabb (Indiana University School of Medicine). An NdeI and a BamHI restriction site were created at the 5' and 3' ends of the pALDH2 cDNA, respectively, by using PCR. The PCR fragments were then cloned into plasmid pT7-7 between 5'-NdeI and 3'-BamHI sites. To make the chimeric precursors, a unique restriction enzyme site, AflII, was introduced between the junction of the presequence and the mature portion without changing the amino acid sequence. The oligonucleotide used for the creation of the AflII site was 5'-TTCGGGCCCCGCCTGGGCCGCCGCCTCTTAAGCGCCGCCGCCACCCAGGCCG TGCCTGCC-3', with the AflII site emphasized. The cDNA fragment from +22 to the stop codon of the precursor cDNA was amplified by PCR using the precursor cDNA as a template. Then the resulting PCR products were digested with ApaI and were subcloned back into the above precursor cDNA in which an ApaI fragment was removed by digesting with ApaI. A plasmid with the correct orientation of the ApaI fragment was selected.

The sense primer used for obtaining pALDH1 and pC-ALDH2 cDNAs was 5'-ACACTTAAGCTCCTCAGGCACGCCAGACT TACCTG-3' (containing AflII site, underlined). 5'-CCTCTTAAG CGCTGCCGCCACCCAGGCCGTGCCTGCCCC-3' (containing the AflII site, underlined) was used for pM-ALDH1 cDNA. The antisense primers (containing the BamHI site) corresponded to the 3'-terminal sequence of either ALDH1 or ALDH2 cDNA. To make pALDH1, ALDH1 cDNA was used as template for PCR to obtain the PCR fragment of ALDH1 cDNA that contained an AflII and a BamHI restriction site at their 5' and 3' ends, respectively. Similarly, M-ALDH1 cDNA was used for the M-ALDH1 cDNA fragment and C-ALDH2 cDNA for the C-ALDH2 fragment to make pM-ALDH1 and pC-ALDH2, respectively. M-ALDH1 and C-ALDH2 cDNA were previously made (Ni et al. 1999). The PCR fragments were inserted back into the above AflII site-containing pALDH2 cDNA cleaved with AflII and BamHI at the 5' and 3' ends, respectively. All of the constructs were confirmed by double-stranded DNA sequencing.

In vitro import of precursor proteins into isolated mitochondria
Mitochondrial isolation and in vitro import were performed as described previously (Pak and Weiner 1990; Waltner and Weiner H 1995; Wang et al. 1989) but with some minor modifications. Briefly, the in vitro transcriptions and translations were performed using the TNT-T7-coupled Reticulocyte Lysate System according to the manufacturer's instructions (Promega) with [35S]methionine (Amersham Life Science) as the labeled amino acid. Saccharomyces cerevisiae mitochondria were purified as previously described (Glick and Pon 1995). Import reactions were performed for 30 min at 30°C in buffer containing 1 mg/mL fatty-acid-free BSA, 0.05 M HEPES, 0.05 M KCl, 0.01 M MgCl2, 2.5 mM Na2 EDTA, 2.0 mM KH2PO4, 0.6 M sorbitol at pH 7.0 in the presence of 1.0 mM ATP, 1.0 mM GTP, 4.0 mM NADH, and 2.0 mM malate. Half the reaction mixture was then treated with Protease K (100 µg/mL) for 15 min at 4°C to digest protein that was not imported. The protease was inactivated by the addition of phenylmethylsulfonyl fluoride (3.0 mM). The samples were layered onto a sorbitol cushion (1 M sorbitol, 0.3 mL) and centrifuged at 11,000 rpm for 7 min on an Eppendorf table top centrifuge. Subsequently, samples were subjected to SDS-PAGE. The gels were dried, and import was analyzed by PhosphorImager storage technology (Molecular Dynamics). The amount of imported protein was expressed as the percentage of total added precursor protein.

Urea denaturation
Circular dichroism measurements were carried out with a JASCO J-600 spectropolarimeter using a 1-mm quartz cell. Expression and purification of all the constructs were performed as described previously (Jeng and Weiner 1991; Ghenbot and Weiner 1992; Wang and Weiner 1995). All the ALDHs (2–10 µM) were incubated at over night at 25°C in 25 mM sodium phosphate, 1 mM EDTA, 0.025% ß-mercaptoethanol buffer (pH 7.5) containing varying concentrations of urea. Unfolding was monitored at 222 nm in the same incubation media at 25°C. Results were the average of 3 repetitive scans, corrected for solvent and cell contributions. Mean residue ellipticities were calculated based on the protein concentrations, as determined by the tyrosinate difference spectral method (Fodor et al. 1989).

Determination of ALDH assembly by sucrose gradient centrifugation
Sucrose gradient centrifugation was performed as described previously (Jeng and Weiner 1991). Briefly, a 12.2-mL 6%–22% sucrose gradient in 100 mM sodium phosphate buffer at pH 7.0, containing 0.025% ß-mercaptoethanol, 0.25 mM phenylmethanesulfonyl fluoride, 2 mM EDTA, and 0.02% sodium azide was made in a polyallomer tube. This sucrose gradient was calibrated with BSA (56 kD) and native mature ALDH2 (220 kD). Reticulocyte lysate (100 µL) was layered on top of the sucrose gradient and centrifuged for 22 h at 37,000 rpm at 4°C in a Beckman SW 41 rotor. Subsequently, 0.4-mL fractions were collected, and aliquots from each fraction were then separated by 10% SDS-PAGE. Immunoblotting or fluorography was used to identify the fractions containing ALDH.

Limited digestion by trypsin
The rate of folding of the proteins was examined as described previously (Mattingly et al. 1993b; Waltner and Weiner 1995). The translation of protein was carried out for 60 min at 30°C. The reaction was terminated by placing the translation product on ice and adding cycloheximide to a final concentration of 50 µM. Subsequently, a 4-µL aliquot of translation product was diluted into 36 µL of trypsin digestion buffer (20 mM HEPPS, 150 mM NaCl, 0.1 mM EDTA at pH 8.3). The remaining translation reaction was incubated for various times at 15°C to allow protein folding to occur. From the diluted translation product, a 4-µL aliquot was removed and added to 36 µL of SDS-PAGE treatment buffer. Trypsin digestion was begun by the addition of 1 µL of 0.3 mg/mL L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated trypsin to the remaining diluted translation product, and the incubation proceeded for 1-, 5-, 10-, or 20-min time periods at 0°C. After each time period had elapsed, 4 µL was removed and diluted into SDS-PAGE treatment buffer. The samples were analyzed on a 10% polyacrylamide gel, and proteins were visualized by autoradiography.

In vitro import of precursor proteins into isolated mitochondria in the presence of urea
Reticulocyte lysates containing precursor ALDHs were precipitated with ammonium sulfate at 50% saturation and dissolved in 8 M urea, 30 mM MOPS at pH 7.5, 10 mM DTT (Kang et al. 1990). The urea-denatured precursor was diluted 25-fold into the import reaction (0.32 M final concentration of urea in the import assay). Import was performed as described above. The presence of 0.32 M urea did not affect the import ability of mitochondria.

Miscellaneous
Magic Minipreps DNA purification system and T4 DNA ligase were from Promega. Restriction enzymes were from New England Biolabs. Taq DNA polymerase was from Boehringer Mannheim. DNA sequencing was performed using the Sequenase version 2.0 kit obtained from U.S. Biochemical (Sanger et al. 1977). The ECL Western blotting kit was from Amersham Life Science. SDS-PAGE was run according to Laemmli (1970).


    Acknowledgments
 
This work was supported in part by NIH Grants AA05812 and GM53169. This is paper No. 16506 from Purdue University Agricultural Experiment station.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Altieri, F., Mattingly, J.R., Jr., Rodriguez-Berrocal, F.J., Youssef, J., Iriarte, A., Wu, T.H., and Martinez-Carrion, M. 1989. Isolation and properties of a liver mitochondrial precursor protein to aspartate aminotransferase expressed in Escherichia coli. J. Biol. Chem. 264: 4782–4786.[Abstract/Free Full Text]

Chen, W.J. and Douglas, M.G. 1987. The role of protein structure in the mitochondrial import pathway. Analysis of the soluble F1-ATPase ß-subunit precursor. J. Biol. Chem. 262: 15598–15604.[Abstract/Free Full Text]

Chirico, W.J. 1992. Dissociation of complexes between 70 kDa stress proteins and presecretory proteins is facilitated by a cytosolic factor. Biochem. Biophys. Res. Commun. 189: 1150–1156.[CrossRef][Medline]

Davoodi, J., Drown, P.M., Bledsoe, R.K., Wallin, R., Reinhart, G.D., and Hutson, S.M. 1998. Overexpression and characterization of the human mitochondrial and cytosolic branched-chain aminotransferases. J. Biol. Chem. 273: 4982–4989.[Abstract/Free Full Text]

Eilers, M. and Schatz, G. 1986. Binding of a specific ligand inhibits import of a purified precursor protein into mitochondria. Nature 322: 228–232.[CrossRef][Medline]

Emr, S., Vassarotti, A., Garrett, J., Geller, B., Takeda, M., and Douglas, M. 1986. The amino terminus of the yeast F1-ATPase ß-subunit precursor functions as a mitochondrial import signal. J. Cell Biol. 102: 523–533.[Abstract/Free Full Text]

Fodor, S.P., Gebhard, R., Lugtenburg, J., Bogomolni, R.A., and Mathies, R.A. 1989. Structure of the retinal chromophore in sensory rhodopsin I from resonance Raman spectroscopy. J. Biol. Chem. 264: 18280–18283.[Abstract/Free Full Text]

Ghenbot, G. and Weiner, H. 1992. Purification of liver aldehyde dehydrogenase by r-hydroxyacetophenone-sepharose affinity matrix and the coelution of chloramphenicol acetyl transferase from the same matrix with recombinantly expressed aldehyde dehydrogenase. Protein Exp. Purif. 3: 470–478.[CrossRef][Medline]

Glick, B. and Pon, L.A. 1995. Isolation of highly purified mitochondria form Saccharomyces cerevisiae. Methods Enzymol. 260: 213–223.

Hainaut, P. and Milner, J. 1992. Interaction of heat-shock protein 70 with p53 translated in vitro: Evidence for interaction with dimeric p53 and for a role in the regulation of p53 conformation. EMBO J. 11: 3513–3520.[Medline]

Hara, H., Tanabe, T., and Kaji, A. 1997. Molecular basis of the altered gag p19 protein (MA) of the transformation-defective mutant of Rous sarcoma virus, tdPH2010. Folia Biol. 43: 175–182.

Hempel, J., Kaiser, R., and Jörnvall, H. 1985. Mitochondrial aldehyde dehydrogenase from human liver. Primary structure, difference in relation to the cytosolic enzyme, and functional correlations. Eur. J. Biochem. 153: 13–28.[Medline]

Hsu, L.C., Tani, K., Fujiyoshi, T., Kurachi, K., and Yoshida, A. 1985. Cloning of cDNAs for human aldehyde dehydrogenases 1 and 2. Proc. Natl. Acad. Sci. USA 92: 2703–2707.

Jeng, J. and Weiner, H. 1991. Purification and characterization of catalytically active precursor of rat liver mitochondrial aldehyde dehydrogenase expressed in Escherichia coli. Arch. Biochem. Biophys. 289: 214–222.[CrossRef][Medline]

Kang, P., Ostermann, J., Shilling, J., Neupert, W., Craig, E., and Pfanner, N. 1990. Requirement for hsp70 in the mitochondrial matrix for translocation and folding of precursor proteins. Nature 348: 137–143.[CrossRef][Medline]

Karslake, C., Piotto, M.E., Pak, Y.K., Weiner, H., and Gorenstein, D.G. 1990. 2D NMR and structural model for a mitochondrial signal peptide bound to a micelle. Biochemistry 29: 9872–9878.[CrossRef][Medline]

Kimura, T., Takeda, S., Kyozuka, J., Asahi, T., Shimamoto, K., and Nakamura, K. 1993. The presequence of a precursor to the {delta}-subunit of sweet potato mitochondrial F1ATPase is not sufficient for the transport of ß-glucuronidase (GUS) into mitochondria of tobacco, rice and yeast cells. Plant Cell Physiol. 34: 345–355.[Abstract/Free Full Text]

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685.[CrossRef][Medline]

Lain, B., Iriarte, A., Mattingly, J.R., Jr., Moreno, J.I., and Martinez-Carrion, M. 1995. Structural features of the precursor to mitochondrial aspartate aminotransferase responsible for binding to hsp70. J. Biol. Chem. 270: 24732–24739.[Abstract/Free Full Text]

Lain, B., Yanez, A., Iriarte, A., and Martinez-Carrion, M. 1998. Aminotransferase variants as probes for the role of the N-terminal region of a mature protein in mitochondrial precursor import and processing. J. Biol. Chem. 273: 4406–4415.[Abstract/Free Full Text]

Mattingly, J.R., Jr., Iriarte, A., and Martinez-Carrion, M. 1993a. Structural features which control folding of homologous proteins in cell-free translation systems. The effect of a mitochondrial-targeting presequence on aspartate aminotransferase. J. Biol. Chem. 268: 26320–26327.[Abstract/Free Full Text]

Mattingly, J.R., Jr., Youssef, J., Iriarte, A., and Martinez-Carrion, M. 1993b. Protein folding in a cell-free translation system. The fate of the precursor to mitochondrial aspartate aminotransferase. J. Biol. Chem. 268: 3925–3937.[Abstract/Free Full Text]

Murakami, K., Tokunaga, F., Iwanaga, S., and Mori, M. 1990. Presequence does not prevent folding of a purified mitochondrial precursor protein and is essential for association with a reticulocyte cytosolic factor(s). J. Biochem. (Tokyo) 108: 207–214.[Abstract/Free Full Text]

Ni, L., Zhou, J., Hurley, T., and Weiner, H. 1999. Human liver mitochondrial aldehyde dehydrogenase: Three-dimensional structure and the restoration of solubility and activity of chimeric forms. Protein Sci. 8: 2784–2790.[Abstract]

Pak, Y. and Weiner, H. 1990. Import of chemically synthesized signal peptides into rat liver mitochondria. J. Biol. Chem. 265: 14298–14307.[Abstract/Free Full Text]

Roise, D., Theiler, F., Horvath, S.J., Tomich, J.M., Richards, J.H., Allison, D.S., and Schatz, G. 1988. Amphiphilicity is essential for mitochondrial presequence function. EMBO J. 7: 649–653.[Medline]

Sandmeier, E. and Christen, P. 1980. Mitochondrial aspartate aminotransferase 27/32-410. Partially active enzyme derivative produced by limited proteolytic cleavage of native enzyme. J. Biol. Chem. 255: 10284–10289.[Abstract/Free Full Text]

Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA Sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463–5467.[Abstract/Free Full Text]

Schatz, G. 1987. 17th Sir Hans Krebs lecture. Signals guiding proteins to their correct locations in mitochondria. Eur. J. Biochem. 165: 1–6.[Medline]

Schofield, A.E., Tanner, M.J., Pinder, J.C., Clough, B., Bayley, P.M., Nash, G.B., Dluzewski, A.R., Reardon, D.M., Cox, T.M., Wilson, R.J., et al. 1992. Basis of unique red cell membrane properties in hereditary ovalocytosis. J. Mol. Biol. 223: 949–958.[CrossRef][Medline]

Thornton, K., Wang, Y., Weiner, H., and Gorenstein, D.G. 1993. Import, processing, and two-dimensional NMR structure of a linker-deleted signal peptide of rat liver mitochondrial aldehyde dehydrogenase. J. Biol. Chem. 268: 19906–19914.[Abstract/Free Full Text]

Van Steeg, H., Oudshoorn, P., Van Hell, B., Polman, J.E., and Grivell, L.A. 1986. Targeting efficiency of a mitochondrial pre-sequence is dependent on the passenger protein. EMBO J. 5: 3643–3650.[Medline]

von Heijne, G. 1986. Mitochondrial targeting sequences may form amphiphilic helices. EMBO J. 5: 1335–1342.[Medline]

Waltner, M. and Weiner H. 1995. Conversion of a nonprocessed mitochondrial precursor protein into one that is processed by the mitochondrial processing peptidase. J. Biol. Chem. 270: 26311–26317.[Abstract/Free Full Text]

Waltner, M., Hammen, P., and Weiner, H. 1996. Influence of the mature portion of a precursor protein on the mitochondrial signal sequence. J. Biol. Chem. 271: 21226–21230.[Abstract/Free Full Text]

Wang, Y. and Weiner, H. 1993. The presequence of rat liver aldehyde dehydrogenase requires the presence of an {alpha}-helix at its N-terminal region which is stabilized by the helix at its C termini. J. Biol. Chem. 268: 4759–4765.[Abstract/Free Full Text]

Wang, X. and Weiner, H. 1995. Involvement of glutamate 268 in the active site of human liver mitochondrial (class 2) aldehyde dehydrogenase as probed by site-directed mutagenesis. Biochemistry 34: 237–243.[CrossRef][Medline]

Wang, T., Farres, J., and Weiner, H. 1989. Liver mitochondrial aldehyde dehydrogenase: In vitro expression, in vitro import, and effect of alcohols on import. Arch. Biochem. Biophys. 272: 440–449.[CrossRef][Medline]

Weldon, S.L., Rando, A., Matathias, A.S., Hod, Y., Kalonick, P.A., Savon, S., Cook, J.S., and Hanson, R.W. 1990. Mitochondrial phosphoenolpyruvate carboxykinase from the chicken. Comparison of the cDNA and protein sequences with the cytosolic isozyme. J. Biol. Chem. 265: 7308–7317.[Abstract/Free Full Text]

Zhou, J. and Weiner, H. 2000. Basis for half-of-the-site reactivity and the dominance of the K487 oriental subunit over the E487 subunit in heterotetrameric human liver mitochondrial aldehyde dehydrogenase. Biochemistry 39: 12019–12024.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. V. Alone, G. Malik, A. Krishnan, and L. C. Garg
Deletion mutations in N-terminal {alpha}1 helix render heat labile enterotoxin B subunit susceptible to degradation
PNAS, October 9, 2007; 104(41): 16056 - 16061.
[Abstract] [Full Text] [PDF]


Home page
Protein Sci.Home page
M. J. Gage and A. S. Robinson
C-terminal hydrophobic interactions play a critical role in oligomeric assembly of the P22 tailspike trimer
Protein Sci., December 1, 2003; 12(12): 2732 - 2747.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Mukhopadhyay, T. S. Heard, X. Wen, P. K. Hammen, and H. Weiner
Location of the Actual Signal in the Negatively Charged Leader Sequence Involved in the Import into the Mitochondrial Matrix Space
J. Biol. Chem., April 11, 2003; 278(16): 13712 - 13718.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Weiner, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Weiner, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS