HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hopkins, C. E. Articles by Tolan, D. R. Search for Related Content PubMed PubMed Citation Articles by Hopkins, C. E. Articles by Tolan, D. R. Social Bookmarking                   What's this?

ACCELERATED COMMUNICATION

Chemical-modification rescue assessed by mass spectrometry demonstrates that -thia-lysine yields the same activity as lysine in aldolase

¹ Department of Biology, Boston University, Boston, Massachusetts 012205, USA
² Department of Biochemistry, Boston University School of Medicine, Boston, Massachusetts 02118-2526, USA
³ Department of Physiology and Biophysics, Boston University School of Medicine, Boston, Massachusetts 02118-2526, USA

Reprint requests to: Dean R. Tolan, Biology Department, Boston University, 5 Cummington St., Boston, MA 02215, USA; e-mail: tolan{at}bu.edu; fax: (617) 353-6340.

(RECEIVED September 21, 2001; FINAL REVISION April 17, 2002; ACCEPTED April 17, 2002)

Article and publication are at http://www.proteinscience.org/cgi/doi/10.1110/ps.3900102.

Abstract

The role of active site residues in fructose 1,6-bisphosphate aldolase is investigated by chemical-modification rescue. An active-site mutation, K107C, is constructed in a background where the four solvent-accessible cysteine residues are converted to alanine. The resulting mutant, tetK107C, when reacted with bromoethylamine (BrEA), shows a 40-fold increase in activity (to 80% that of wild type). Determination of the sites and their degree of modification using electrospray ionization Fourier transform mass spectrometry (ESI-FTMS) is developed, allowing correlation of activity after chemical modification rescue to the degree of modification. The stoichiometry of the reaction is 2.5 aminoethylations per subunit, as measured by ESI-FTMS. Protein modification with a double-labeled mix (1:1) of natural abundance isotope (d₀-BrEA) and 2-bromoethyl-1,1,2,2-d4-amine hydrobromide (d₄-BrEA), followed by dialysis and trypsin digestion, shows aminoethylated peptides as "twin peptides" separated by four mass units in ESI-FTMS analysis. Using this detection procedure under nondenaturing (native) conditions, C107 is aminoethylated, whereas the four buried thiols remain unlabeled. Aminoethylation of other residues is observed, and correlates with those peptides containing histidine, methionine, and/or the amino terminus. Quantification of the aminoethylation reaction is achieved by labeling with nondeuterated d₀-BrEA under denaturing conditions following double labeling under native conditions. In addition to complete labeling all five thiols, the intensity of the d₀-BrEA peak for C107 containing peptides increases, and the change in the d₀/d₄ ratio between native and denaturing conditions shows 82 ± 4.5% aminoethylation at C107. This correlation of modification with the recovered activity, indicates that -thia-lysine replaces lysine in the catalytic mechanism. Kinetic constants measured for the rescued K107C mutant enzyme with the substrates fructose 1-phosphate and fructose 1,6-bisphosphate are consistent with the role of the positively charged lysine binding to the C6-phosphate. ESI-FTMS, combined with this double-labeling procedure, allows precise identification of sites and measurement of degree of protein modification.

Keywords: Aldolase; chemical modification rescue; bromoethylamine; mass spectrometry; enzyme mechanism; protein modification; alkylation; cysteine; lysine

Insight into the function of catalytic groups at the active site of enzymes has been obtained by chemical modification rescue experiments (Benkovic et al. 1972; Smiley and Jones 1992; Kim et al. 1994; Highbarger et al. 1996; Nash et al. 1997; Bochar et al. 1999). However, separation of effects of incomplete modification from the effects of the substitution has not been achieved. Smith and Hartman (1988) rescued an inactive K329C mutant of ribulose bisphosphate carboxylase/oxygenase by modification with bromo-ethylamine (BrEA) to form the analog of lysine, -thia-lysine. Aminoethylation of the mutant enzyme restored activity to 30% of the wild type (wt). Aminoethylation of wt, however, resulted in 30% inhibition, leading to the speculation that an inhibitory modification of an endogenous cysteine occurred elsewhere in the protein. Planas and Kirsch (1991) performed aminoethylation of a K258C mutant of aspartate aminotransferase, which resulted in 2% wt activity. When the rescue experiment was performed on a K258C mutant enzyme wherein all five endogenous cysteines were substituted by alanine (Gloss and Kirsch 1995), 10% of wt activity was observed. Clearly, undesirable reaction at endogenous thiols or other nucleophiles is a concern in chemical modification rescue with BrEA. Additional insight can be gained by the determination of the sites and level of modification.

Chemical modification rescue has not been reported for class I aldolases, which have three important active-site lysines (K107, K146, and K229) that are necessary for cleavage of fructose-1,6-bisphosphate (Fru1,6P2) into glyceraldehyde-3-phosphate and dihydroxyacetone phosphate (Grazi et al. 1962; Morris and Tolan 1994; Wang et al. 1996). One crystal structure of aldolase with a noncovalently bound Fru1,6P2 showed that the C6-phosphate of the substrate was within 3 Å of the -amino group of K107 (Dalby et al. 1999). Consistent with a phosphate-binding role, the k_cat/K_m of a K107A mutant toward Fru1,6P2 was 500-fold reduced (Wang et al. 1996), but was unchanged with fructose-1-phosphate (Fru1P) (Choi et al. 1999). These results suggest that the -amino group of K107 binds the C6-phosphate of the Fru1,6P2; however, the loss of activity due to mutagenesis cannot rule out any indirect effects. Thus, this important binding residue was targeted for chemical modification rescue to investigate its role through a gain in function.

Interpreting data from chemical modification rescue experiments is augmented by measurement of the specificity and efficiency of the modification reaction. Mass spectrometry is a powerful method for determining the sites of chemically induced or physiologically induced protein modifications (Resing et al. 1995; Chen et al. 1999; Oda et al. 1999; James 2000; Patterson 2000). For instance, in a proteomic study, Gygi et al. (1999) employed thiol-specific, isotope-coded affinity tags to quantitatively analyze changes in protein expression. Saccharomyces cerevisiae were grown on either ethanol or galactose as a carbon source, and total protein was labeled with either a deuterated or nondeuterated affinity tag, respectively. By combining the preparations and performing LC-MS, the differences in protein expression were observed and quantified.

In the present study, a mass spectrometric approach was used to solve the problem of identifying and quantifying sites of chemical modification with BrEA in a K107C mutant of aldolase. Aminoethylation resulted in recovery of 80% of wt activity. The question arises as to whether this site was 80% modified or completely modified, but the -thia-lysine was only 80% as effective as lysine at this position. Electrospray-ionization Fourier-transform mass spectrometry (ESI-FTMS) was used to detect the amount of aminoethylation per enzyme monomer. All sites of modification were determined by utilizing a double-labeling strategy with two isotopic forms of BrEA, Br-CH₂-CH₂-NH₃⁺ (d₀-BrEA) and Br-CD₂-CD₂-NH₃⁺ (d₄-BrEA), followed by trypsin digestion and ESI-FTMS identification. The degree of modification was measured at each site after double-labeling protein with d₀/d₄-BrEA (1:1) under nondenaturing (native) conditions followed by labeling under denaturing conditions with d₀-BrEA. Normalizing to the peak of the d₄-BrEA–modified peptide, the relative increase in the d₀-BrEA peak revealed the amounts of reacted and unreacted thiol present under native conditions. The 80% wt activity restored in a K107C mutant enzyme correlated with 80% modification at C107. Furthermore, the high sensitivity of ESI-FT-MS enabled detection of other low-level modifications at sites other than cysteine.

Results

Chemical modification rescue
Reaction with nontarget cysteine residues was limited by mutating the codons for four solvent-exposed cysteines (C72, C239, C289, and C338; Lai et al. 1971) to alanine codons. The resulting substituted protein, gtet, exhibited wt kinetics (Table 1). A K107C substitution constructed in the background gtet (tetK107C) resulted in a 700-fold drop in k_cat/K_m, similar to that in a K107A-substituted enzyme in wt background (Wang et al. 1996). When tetK107C was treated with BrEA for 8 h, the modified protein, tetK107C–EA, recovered 80% of gtet–EA specific activity (Fig. 1A). The k_cat measured with enzyme after 20-h incubation was 82 ± 2 % that of gtet-EA. The k_cat/K_m of gtet–EA did not significantly differ from that of similarly treated wt (Table 1). In addition, the specific activity of tetK107C toward Fru1P was only fourfold lower than gtet and regained wild-type activity after modification (tetK107C–EA).

View larger version (35K): [in this window] [in a new window]   Fig. 1. Chemical modification rescue of tetK107C. (A) Modification of tetK107C with BrEA monitored by recovery of specific activity in units aldolase activity/mg. Conditions: 50 mM BrEA, 200 mM AMPSO, pH 8.9, 0.01 mM protein, 25°C. (•), Unreacted tetK107C; (), tetK107C–EA; (), gtet–EA. (B) Fourier-transform spectrum of ESI-FTMS of unreacted tetK107C. (C) Deconvolution spectrum of (B). (D) Deconvolution spectrum of aminoethylated tetK107C–EA. Modification conditions: 50 mM BrEA, 200 mM Tris-Cl, pH 8.9, 20°C, 20 h. Protein samples introduced into the mass spectrometer were 20 µM aldolase in 100 mM NH4OAc/1% formic acid.

View larger version (18K): [in this window] [in a new window]   Fig. 2. Mass spectrum of modified, digested tetK107C–EA. ESI-FTMS of tetK107C–EA trypsin peptides double-labeled with 1:1 d0/d4-BrEA (100 mM total) as in Figure 1D. For clarity, only major peaks are labeled with assignments defined by the method of Chowdhury et al. (1990). (Inset) Overlapping peak sets of T26 and T29 and methionine oxidation peak, T26-Met-ox (see Table 3). The effective concentration of d4-BrEA was determined by comparing the rate of activity rescue to that of commercial BrEA (d0-BrEA) determined at known concentrations.

View larger version (43K): [in this window] [in a new window]   Fig. 3. Tryptic peptide map of tetK107C-EA aldolase. Assigned tryptic fragments are depicted by shaded boxes. Light-shaded boxes are completely digested peptides and dark-shaded boxes are incompletely digested peptides. Single arrows denote cysteine positions, and double arrows denote histidine or methionine positions. Amino acid is derived from the DNA sequence of the gtet expression plasmid with numbering as defined by Tolan et al. (1984). Nomenclature for tryptic peptides as defined in Figure 2 (Chowdhury et al. 1990).

Employing a double-labeling strategy (1:1 mixture of d₀-BrEA and d₄-BrEA), the detection of two sets of isotope-resolved peaks separated by four mass units easily identified the modification sites. Figure 4A shows that at the T₁₄–(d₀)–EA and T₁₄–(d₄)–EA the peak sets are separated by 2.018 on the m/z axis. At a 2+ charge state, this separation correlated with the 4.03 mass unit difference expected after double labeling. In this way, seven modified peptides (T₁, T₃, T₁₄/T₅₁, T₂₁, T₂₆, and T₂₇) were observed (Table 3). Of these, only T₁₄ and T₅₁ contained cysteine (C107). Peptides of masses corresponding to unmodified forms of T₁₄ and T₅₁ were not observed, suggesting the peptide fragment was present mostly in the modified form. When labeling was performed on denatured protein, peptides containing internal cysteines (T₁₆, T₂₀, T₂₄, and T₆₀) became modified. By performing double labeling under native conditions and subsequent labeling under denaturing conditions with only d₀-BrEA, peptides containing internal cysteines were modified only in the d₀ form. For example, Figure 4C–D shows the results of modification of the T₂₀ peptide, which contains C149. Under native conditions T₂₀ was not modified (Fig. 4C, m/z 462.28), but was completely modified under denaturing conditions (Fig. 4D, m/z 505.33). Neither the d₄-aminoethylated form (m/z 509.34), nor the d₀-aminoethylated form (m/z 505.33), was observed under native conditions, which shows that labeling of T₂₀ occurred only in denaturing conditions. Similar labeling results were observed for the three other internal cysteine peptides (T₁₆, T₂₄, and T₆₀), indicating the four internal thiols were inaccessible to BrEA modification in the native state. Modification at sites other than cysteine was observed for peptides T₁, T₃/T₄₀, T₁₁/T₄₈, T₂₁, T₂₆, T₂₇/T₆₅, and T₃₈ (Table 3). For example, peptides T₁ and T₂₁ were clearly modified under native conditions (Fig. 4E), yet they contain no cysteine. Under denaturing conditions (Fig. 4F), the T₁ peptide (PHSHPALTPEQK) was modified completely. For the T₂₁ peptide, further modification after denaturation was evident by the increase in the d₀-aminoethylated form, although modification was incomplete.

View larger version (24K): [in this window] [in a new window]   Fig. 4. Mass spectra of selected ions from tryptic digest of tetK107C–EA. (A) Double labeling of C107-containing T14 peptide under native conditions. The d0 bracket denotes isotope peaks of T14 reacted with Br-CH2-CH2-NH3+ (50 mM) and d4 bracket denotes reaction with Br-CD2-CD2-NH3+ (50 mM). (B) Material from (A) was denatured and reacted with d0-BrEA (100 mM). (C) Two regions of m/z spectrum corresponding to positions of unmodified (m/z 462.29) and modified (m/z 505.33) T20 peptide under native conditions. (D) Sample treated as for (C) after subsequent labeling under denaturing conditions. (E) Peptides, T1 and T21, exhibiting aminoethylation at residues other than cysteine under native conditions. (F) As in (E), except under denaturing conditions.

Previous studies have shown the efficacy of double-labeling strategies with ESI-FTMS in the rapid identification of protein modification sites (Gygi et al. 1999; Goshe et al. 2001). For instance, a suicide inhibitor of thiaminease I, 4-amino-6-chloro-2,5-dimethylpyrimidine was synthesized with either a 2-(d₀)-methyl or a 2-(d₃)-methyl and combined in a 1:2 ratio to facilitate identification of the modified peak in ESI-FTMS of an Asp-N digest (Kelleher et al. 1997). The modified peptide was identified as a set of m/z peaks with a 32:68 ratio. In this report, the calculated d₀/d₄ isotope ratio was 50:50, but the observed average ratio was 46:54 ± 1.2%, demonstrating that the technique provides a precise measure of the isotope-label ratio. In this report, it is the change in the ratio between peak intensities under native and denaturing conditions that allows accurate quantification of labeling when the chemistry of modification is not limiting. At C107, the change in the labeling ratio demonstrated that the level of modification (77–86%) was similar to the level of recovered activity (81–84%), indicating the lack of complete activity recovery is due to incomplete modification at C107 and not to inhibitory reactions at nontarget residues or to a difference in the chemistry of a -thia-lysine compared to lysine. Clearly, using the change in d₀/d₄ ratio for quantifying the degree of modification under native conditions requires that the site of modification react completely in the denatured state. For instance, T₂₁ has a calculated modification ratio of 55%, yet, as apparent from the two sets of peaks shown in Figure 4F, it remains only partially labeled (ca. 30%) even after reaction under denaturing conditions. These sites were all less reactive than cysteine.

Aminoethylation at sites other than cysteine
In the current study, ESI-FTMS analysis has indicated reaction of BrEA with sites other than cysteine (Table 4). Of these, only T₁ was >90% modified (under native conditions) and thus, along with the target C107, accounts for a majority of the modification observed. The identity of the nucleophiles is unclear. Previous reports have shown BrEA may react with methionine (Schroeder et al. 1967), histidine, and/or the amino terminus (Raftery and Cole 1963). In this report, histidine is common to all modified peptides that do not contain cysteine, and thus is the likely site of modification. Furthermore, three peptides (T₃₈, T₄₈, and T₆₀) were aminoethylated at a number of sites greater than the number of histidines and methionines, which may be explained by bis-modification at histidine. Bis-substitution has been observed with other histidine-specific reagents such as diethylpyrocarbonate (Miles 1977).

In conclusion, the gain of near wild-type activity for the chemical-modification rescue of the C107 mutant aldolase shows unequivocally that K107 has a role in C6-phosphate binding at the active site. The C6-phosphate binding site has been alternatively implicated as R303 from X-ray crystallography data (Choi et al. 1999), or K107 from chemical modification (Lai et al. 1974), site-directed mutagenesis (Takasaki et al. 1990; Wang et al. 1996; Choi et al. 1999), and X-ray crystallography data (Dalby et al. 1999). These two residues are 10 Å apart in the crystal structure (Choi et al. 1999; Dalby et al. 1999). A loss of activity toward Fru1,6P2, with minimal effect toward Fru1P (Choi et al. 1999) has been cited as evidence for the C6-phosphate binding role by K107. However, these previous studies could not rule out possible explanations for this preferential loss of activity based on indirect causes such as folding or subtle conformational changes due to the loss of the lysyl-residue. This report clearly shows that modification of C107 to a -thia-lysine is responsible for the regained activity, and any indirect effects from site-directed mutagenesis at this site can be ruled out. Furthermore, ESI-FTMS could detect all significant sites of chemical modification. A novel double-labeling strategy, using native and denaturing conditions, quantified the amount of labeling at C107 based on the change in isotope ratio. Undesirable reaction with buried thiols did not occur in aldolase under native conditions, but reaction with residues other than cysteine was apparent. The amount of aminoethylation was in agreement with the level of activity attained, thus implying that steric and/or electronic differences between a "rescued" lysine (-thia-lysine) and lysine do not significantly affect the role of the amino acid in the active site. Alternatively, but less likely, -thia-lysine may participate in catalysis more effectively than lysine, but the effect is compensated by the negative effect of modification at sites other than cysteine.

Materials and methods

Chemicals
The chemicals used were 2-bromoethylamine hydrobromide (Fluka, Inc.); (1,1-2,2-d₄)-ethanolamine hydrochloride (Cambridge Isotope Laboratories, Inc.); CM-Sepharose Fast Flow (Pharmacia Biotech, Inc.); sequencing-grade modified-trypsin (Roche Diagnostic GmbH). All other chemicals were reagent grade or better.

Plasmids and PCR mutagenesis
The construction of plasmids pPB1 and pPB14 has been described elsewhere (Beernink and Tolan 1992; Morris and Tolan 1993). Briefly, pPB1 is an `ATG' vector that has pUC19 origin of replication and the trc promoter. The pPB14 clone expresses wt rabbit-muscle Fru1,6P2 aldolase in pPB1. Of the eight cysteines present in aldolase, four are solvent accessible (C72, C239, C289, C338) (Lai et al. 1971) and were substituted by alanine in pPB14 by modification of the overlap-extension PCR method, as reviewed by Ling and Robinson (1997). The primers (National Biosciences, Inc.) for mutagenesis were: geneU, acgaccgagcgcagcgagtcagtgag; 72U, gaaccccgccatcgggggcgtc; 72L, gacgcccccgatggcggggttc; 107U, gttgtgggcatctgcgtagacaagg; 107L, tgtctacgcagatgcccacaa cacc; 239U, cctggccatgccgccacccagaagtattct; 239L, gagaatacttc tgggtggcggcatggccagg; 289U, caacaaggcccccctgctgaagccgtg; 289L, tcagcaggggggccttgttgatggcgt; 338U, cgccgcccaagggaagta caccccgag; 338L, gtacttcccttgggcggcgaggctgttgg; geneL, gctactgccgccaggcaaactgttttatca. Mutagenic pairs of primers: 72U/72L, 239U/239L, 289U/289L, 338U/338L were used to substitute alanine for cysteine codons. Individual amplicons (geneU/72L, 72U/239L, 239U/289L, 289U/338L, 338U/geneU) from pPB14 (1.0 fmole) were gel purified, combined, and used for PCR with the flanking primer pair geneU/geneL, which anneals outside the coding region and EcoR I/Hind III restriction sites. The flanking PCR product was phenol/chloroform extracted, ethanol precipitated, and EcoR I/Hind III digested for insertion into pPB1. The resulting mutant, gtet, was used as the background for construction of tetK107C. Mutagenic primer pairs for tetK107C were geneU/107L and 107U/geneL. The clones were confirmed by DNA sequencing on an ABI 377 sequencer using the big dye terminator method (Applied Biosystems, Inc.).

Protein expression and purification
Six clones were cultured overnight and the clone exhibiting greatest expression by SDS-PAGE was used to inoculate 1L of 2xYT media and grown for 24 h at 37°C. The cells were pelleted, lysed by a French press, and the lysate cleared by centrifugation at 25,000g for 45 min. Protein was precipitated by adding (NH₄)₂SO₄ to 70% saturation at 4°C. Centrifugation at 25,000g for 15 min yielded a pellet that was resuspended in nitrogen-purged dialysis buffer (10 mM sodium phosphate, pH 6.7, 50 mM EDTA, 1 mM DTT, 25 mM PMSF, and 25 ng/mL pepstatin A). DNase I and RNase A were added at 5 mg/mL. Following dialysis, the protein was loaded on a (CM-Sepharose fast-flow column (Amersham Pharmacia Biotech, Inc.) in 0.5x dialysis buffer, washed with TGK buffer (50 mM Taps, 25 mM glycine, 25 mM KOH, pH 8.3, 0.1 mM DTT, 25 mM PMSF, and 25 ng/mL pepstatin A), and eluted with TGK buffer containing 0.5 mM Fru1,6P2. The eluate was precipitated in 70% (NH₄)₂SO₄. Aldolase (100–200 g/L culture) was 95% pure as determined by SDS-PAGE. Aliquots were removed and dialyzed in 1x dialysis buffer. Protein concentration was determined based on absorbance at 280 nm (^0.1% = 0.91) (Baranowski and Niederland 1949).

Enzyme kinetics
Measurement of enzyme activity employed a coupled-enzyme assay (Racker 1952) at 30°C on a SpectroMAX 190 (Molecular Devices, Inc.). In a microtiter plate, reactions were composed of protein (50 µL of either 0.1 µM or 5 µM in subunits) and cocktail buffer (150 µL of 100 mM TEA-Cl, pH 7.4, 20 mM Na-EDTA, 0.3 mM NADH, and 20 µg/mL GDH/TIM) followed by addition of substrate Fru1,6P2 (100 µL of 0.94 to 540 µM). Assays for specific activity toward Fru1P were done similarly with 20 mM Fru1P.

Synthesis of deuterated 2-bromo-ethylamine
Deuterated BrEA was synthesized from deuterated ethanolamine and HBr by modification of the method of Wystrach et al. (1955). In a hood, ethanol-1,1,2,2-d₄-amine (0.5 mg) was added dropwise to HBr (conc.) in a distillation flask and heated to boiling (105°C). The solution was refluxed at 135–140°C for 1 h, cooled for 10 min, fitted to a vacuum distillation apparatus (100 mTorr), and reheated until the solution volume was 0.1x starting. The solution was maintained at 105–110°C for 3–4 h until reflux stopped. Product was dissolved in H₂O. The yield was 70–80% as determined by TLC on dried silica gel plates pretreated with 0.5 M sodium phosphate solution (dibasic, pH 8.9). Samples were mobilized using 0.5 M dibasic Na₂HPO₄:acetone (1:19) and visualized with iodine vapor (BrEA = 0.54 rf, ethanolamine = 0.03 rf).

Protein aminoethylation
Aminoethylation was initiated by addition of BrEA (50 mM) into buffer (AMPSO, pH 9.5, or Tris-Cl, pH 8.9) (200 mM) followed by addition of protein (50 µM). Reaction at 25°C was monitored by activity assays. For ESI-FT-MS of intact protein, reactions were terminated at 24 h by dialysis into 100 mM ammonium acetate at 4°C.

Double labeling
Two preparations of modified aldolase were generated, native and denatured. In the native preparation, a BrEA mixture resulting in 50 mM d₀-BrEA (Fluka, Inc.) and 50 mM d₄-BrEA was buffered at 200 mM Tris-Cl, pH 8.9. Reaction was initiated by addition of protein (100 µM), incubated for 22 h at 20°C, and terminated by dialysis at 4°C. For the denatured preparation, an aliquot of the protein treated as above was further treated by buffer exchange into 200 mM Tris-Cl pH 8.9, 4 M urea using a microcon-30 concentrator (Millipore, Inc.) and modified with d₀-BrEA (200 µM protein and 100 mM d₀-BrEA, 37°C, 14 h). This concentration of urea was sufficient to allow complete modification of buried cysteines (see Results). Both native and denatured samples were dialyzed twice against H₂O, and again against 100 mM ammonium acetate. Trypsin digestion (1:200 w/w) was at 37°C for 15 h.

Mass spectrometry
The FTMS was performed on a modified IonSpec system employing a 7T active-shielded superconducting electromagnet using a capacitively coupled closed cylindrical Penning trap. An electrospray ion source (Analytica, Inc.) was modified with a home-built nano-ESI interface using pulled glass capillary tips. Samples were analyzed with standard instrument operating parameters processed using varying degrees of truncation with at least one zerofill prior to Fourier transform with the Boston University Data Analysis (BUDA) software developed by the Boston University Mass Spectrometry Resource (P.B. O'Connor, personal communication). Deconvolutions were performed using the Fenn algorithm (Mann and Fenn 1989).

Acknowledgments

We thank Dr. Jonathan Lee and Dr. Kay Choi for many helpful discussions and comments. This work was supported by NIH GM60616 (D.R.T. and K.N.A.), NIH DK43512 (D.R.T.), and NIH P41-RR100888 (C.E.C.).

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.

References

Baranowski, T. and Niederland, T.R. 1949. Aldolase activity of myogen A. J. Biol. Chem. 180: 543–551.[Free Full Text]

Beernink, P.T. and Tolan, D.R. 1992. Construction of a high-copy "ATG vector" for expression in Escherichia coli. Protein Exp. Purific. 3: 332–336.

Benkovic, S.J., Engle, J.L., and Mildvan, A.S. 1972. Magnetic resonance studies of the anomeric distribution and manganese binding properties of fructose phosphates. Biochem. Biophys. Res. Commun. 47: 852–858.[CrossRef][Medline]

Bochar, D.A., Tabernero, L., Stauffacher, C.V., and Rodwell, V.W. 1999. Aminoethylcysteine can replace the function of the essential active site lysine of Pseudomonas mevalonii 3-hydroxy-3-methylglutaryl coenzyme A reductase. Biochemistry 38: 8879–8883.[CrossRef][Medline]

Chen, X., Chen, Y.H., and Anderson, V.E. 1999. Protein cross-links: Universal isolation and characterization by isotopic derivatization and electrospray ionization mass spectrometry. Anal. Biochem. 273: 192–203.[CrossRef][Medline]

Choi, K.H., Mazurkie, A.S., Morris, A.J., Utheza, D., Tolan, D.R., and Allen, K.N. 1999. Structure of a fructose-1,6-bis(phosphate) aldolase liganded to its natural substrate in a cleavage-defective mutant at 2.3 Å. Biochemistry 38: 12655–12664.[CrossRef][Medline]

Chowdhury, S.K., Katta, V., and Chait, B.T. 1990. Electrospray ionization mass spectrometric peptide mapping: A rapid, sensitive technique for protein structure analysis. Biochem. Biophys. Res. Commun. 167: 686–692.[CrossRef][Medline]

Dalby, A., Dauter, Z., and Littlechild, J.A. 1999. Crystal structure of human muscle aldolase complexed with fructose 1,6– bisphosphate: Mechanistic implications. Protein Sci. 8: 291–297.[Abstract]

Gloss, L.M. and Kirsch, J.F. 1995. Examining the structural and chemical flexibility of the active site base, Lys-258, of Escherichia coli aspartate aminotransferase by replacement with unnatural amino acids. Biochemistry 34: 12323–12332.[CrossRef][Medline]

Goshe, M.B., Conrads, T.P., Panisko, E.A., Angell, N.H., Veenstra, T.D., and Smith, R.D. 2001. Phosphoprotein isotope-coded affinity tag approach for isolating and quantitating phosphopeptides in proteome-wide analyses. Anal. Chem. 73: 2578–2586.[Medline]

Grazi, E., Rowley, P.T., Chang, T., Tchola, O., and Horecker, B.L. 1962. The mechanisms of action of aldolases III: Schiff base formation with lysine. Biochem. Biophys. Res. Commun. 9: 38–43.[CrossRef][Medline]

Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H., and Aebersold, R. 1999. Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17: 994–999.[CrossRef][Medline]

Highbarger, L.A., Gerlt, J.A., and Kenyon, G.L. 1996. Mechanism of the reaction catalyzed by acetoacetate decarboxylase. Importance of lysine 116 in determining the pKa of active-site lysine 115. Biochemistry 35: 41–46.[CrossRef][Medline]

James, P. 2000. Proteome research: Mass spectrometry. Springer Verlag, New York.

Kelleher, N.L., Nicewonger, R.B., Begley, T.P., and McLafferty, F.W. 1997. Identification of modification sites in large biomolecules by stable isotope labeling and tandem high resolution mass spectrometry. The active site nucleophile of thiaminase I. J. Biol. Chem. 272: 32215–32220.[Abstract/Free Full Text]

Kim, D.W., Yoshimura, T., Esaki, N., Satoh, E., and Soda, K. 1994. Studies of the active-site lysyl residue of thermostable aspartate aminotransferase: Combination of site-directed mutagenesis and chemical modification. J. Biochem. (Tokyo) 115: 93–97.[Abstract/Free Full Text]

Lai, C.Y., Chen, C., Smith, J.D., and Horecker, B.L. 1971. The number, distribution and functional implication of sulfhydryl groups in rabbit muscle aldolase. Biochem. Biophys. Res. Commun. 45: 1497–1505.[CrossRef][Medline]

Lai, C.Y., Nakai, N., and Chang, D. 1974. Amino acid sequence of rabbit muscle aldolase and the structure of the active center. Science 183: 1204–1206.[Abstract/Free Full Text]

Ling, M.M. and Robinson, B.H. 1997. Approaches to DNA mutagenesis: An overview. Anal. Biochem. 254: 157–178.[CrossRef][Medline]

Mann, M., Meng, C.K., and Fenn, J.B. 1989. Interpreting mass spectra of multiply charged ions. Anal. Chem. 61: 1702–1708.[CrossRef]

Miles, E.W. 1977. Modification of histidyl residues in proteins by diethylpyrocarbonate. Methods Enzymol. 47: 431–442.[Medline]

Morris, A.J. and Tolan, D.R. 1993. Site-directed mutagenesis identifies aspartate 33 as a previously unidentified critical residue in the catalytic mechanism of rabbit aldolase A. J. Biol. Chem. 268: 1095–1100.[Abstract/Free Full Text]

———. 1994. Lysine-146 of rabbit muscle aldolase is essential for cleavage and condensation of the C3–C4 bond of fructose 1,6-bis(phosphate). Biochemistry. 33: 12291–12297.[CrossRef][Medline]

Nash, H.M., Lu, R., Lane, W.S., and Verdine, G.L. 1997. The critical active-site amine of the human 8-oxoguanine DNA glycosylase, hOgg1: Direct identification, ablation and chemical reconstitution. Chem. Biol. 4: 693–702.[CrossRef][Medline]

Oda, Y., Huang, K., Cross, F.R., Cowburn, D., and Chait, B.T. 1999. Accurate quantitation of protein expression and site-specific phosphorylation. Proc. Natl. Acad. Sci. 96: 6591–6596.[Abstract/Free Full Text]

Patterson, S.D. 2000. Proteomics: The industrialization of protein chemistry. Curr. Opin. Biotechnol. 11: 413–418.[CrossRef][Medline]

Planas, A. and Kirsch, J.F. 1991. Reengineering the catalytic lysine of aspartate aminotransferase by chemical elaboration of a genetically introduced cysteine. Biochemistry 30: 8268–8276.[CrossRef][Medline]

Racker, E. 1952. Enzymatic synthesis and breakdown of desoxyribose phosphate. J. Biol. Chem. 196: 347–351.[Free Full Text]

Raftery, M.A. and Cole, R.D. 1963. Tryptic cleavage at cysteinyl peptide bonds. Biochem. Biophys. Res. Commun. 10: 467–472.[CrossRef][Medline]

Resing, K.A., Johnson, R.S., and Walsh, K.A. 1995. Mass spectrometric analysis of 21 phosphorylation sites in the internal repeat of rat profilaggrin, precursor of an intermediate filament associated protein. Biochemistry 34: 9477–9487.[CrossRef][Medline]

Schroeder, W.A., Shelton, J.R., and Robberson, B. 1967. Modification of methionyl residues during aminoethylation. Biochim. Biophys. Acta 147: 590–592.[Medline]

Smiley, J.A. and Jones, M.E. 1992. A unique catalytic and inhibitor-binding role for Lys93 of yeast orotidylate decarboxylase. Biochemistry 31: 12162–12168.[CrossRef][Medline]

Smith, H.B. and Hartman, F.C. 1988. Restoration of activity to catalytically deficient mutants of ribulosebisphosphate carboxylase/oxygenase by aminoethylation. J. Biol. Chem. 263: 4921–4925.[Abstract/Free Full Text]

Takasaki, Y., Kitajima, Y., Takahashi, I., Sakakibara, M., Mukai, T., and Hori, K. 1990. Structural studies on aldolase isozymes through protein engineering. Prog. Clin. Biol. Res. 344: 935–953.[Medline]

Tolan, D.R., Amsden, A.B., Putney, S.D., Urdea, M.S., and Penhoet, E.E. 1984. The complete nucleotide sequence for rabbit muscle aldolase A messenger RNA. J. Biol. Chem. 259: 1127–1131.[Abstract/Free Full Text]

Wang, J., Morris, A.J., Tolan, D.R., and Pagliaro, L. 1996. The molecular nature of the F-actin binding activity of aldolase revealed with site-directed mutants. J. Biol. Chem. 271: 6861–6865.[Abstract/Free Full Text]

Wystrach, V.P., Kaiser, D.W., and Schaefer, F.C. 1955. Preparation of ethylenimine and triethylenemelamine. J. Am. Chem. Soc. 77: 5915–5918.[CrossRef]

CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				P. Venkataraman, R. A. Lamb, and L. H. Pinto Chemical Rescue of Histidine Selectivity Filter Mutants of the M2 Ion Channel of Influenza A Virus J. Biol. Chem., June 3, 2005; 280(22): 21463 - 21472. [Abstract] [Full Text] [PDF]

				D. Golemi-Kotra, S. O. Meroueh, C. Kim, S. B. Vakulenko, A. Bulychev, A. J. Stemmler, T. L. Stemmler, and S. Mobashery The Importance of a Critical Protonation State and the Fate of the Catalytic Steps in Class A {beta}-Lactamases and Penicillin-binding Proteins J. Biol. Chem., August 13, 2004; 279(33): 34665 - 34673. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hopkins, C. E. Articles by Tolan, D. R. Search for Related Content PubMed PubMed Citation Articles by Hopkins, C. E. Articles by Tolan, D. R. Social Bookmarking                   What's this?