| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
-hemolysin at intermediate stages of pore formation by engineered disulfide bonds
1 Department of Biochemistry and Molecular Biophysics and
2 Howard Hughes Medical Institute, Columbia University, New York, New York 10032, USA
Reprint requests to: Eric Gouaux, Department of Biochemistry and Molecular Biophysics, Columbia University, 650 West 168th Street, New York, NY 10032, USA; e-mail: jeg52{at}columbia.edu; fax: (212) 305-8174.
(RECEIVED September 9, 2002; FINAL REVISION January 24, 2003; ACCEPTED January 27, 2003)
Article and publication are at http://www.proteinscience.org/cgi/doi/10.1110/ps.0231203.
 |
Abstract |
|---|
 TOP Abstract IntroductionResultsDiscussionMaterials and methodsReferences |
|---|
-Hemolysin (HL) is secreted by Staphylococcus aureus as a water-soluble monomer that assembles into a heptamer to form a transmembrane pore on a target membrane. The crystal structures of the LukF water-soluble monomer and the membrane-bound -hemolysin heptamer show that large conformational changes occur during assembly. However, the mechanism of assembly and pore formation is still unclear, primarily because of the difficulty in obtaining structural information on assembly intermediates. Our goal is to use disulfide bonds to selectively arrest and release HL from intermediate stages of the assembly process and to use these mutants to test mechanistic hypotheses. To accomplish this, we created four double cysteine mutants, D108C/K154C (HL-A), M113C/K147C (HL-B), H48C/ N121C (HL-C), I5C/G130C (HL-D), in which disulfide bonds may form between the pre-stem domain and the ß-sandwich domain to prevent pre-stem rearrangement and membrane insertion. Among the four mutants, HL-A is remarkably stable, is produced at a level at least 10-fold greater than that of the wild-type protein, is monomeric in aqueous solution, and has hemolytic activity that can be regulated by the presence or absence of reducing agents. Cross-linking analysis showed that HL-A assembles on a membrane into an oligomer, which is likely to be a heptamer, in the absence of a reducing agent, suggesting that oxidized HL-A is halted at a heptameric prepore state. Therefore, conformational rearrangements at positions 108 and 154 are critical for the completion of HL assembly but are not essential for membrane binding or for formation of an oligomeric prepore intermediate.
Keywords: Double cysteine mutants; disulfide bonds; assembly intermediate; pore-forming toxin; Staphylococcal -hemolysin
Abbreviations: HL, -Hemolysin • Luk, leukocidin • 
HL, -hemolysin • SEC, size-exclusion chromatography • ßME, ß-mercaptoethanol • DTT, dithiothreitol • DiC8PC, dioctanoyl phosphatidyl choline • GA, glutaraldehyde • WT-His6, wild-type -hemolysin with a carboxyl terminal hexa-histidine tag • RBC, rabbit blood cells • SDS-PAGE, SDS polyacrylamide gel electrophoresis
|
Introduction |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
-hemolysin (HL) is an ideal molecule to study to determine mechanisms of membrane protein assembly and insertion (Heuck et al. 2001; Prevost et al. 2001; Montoya and Gouaux 2003).
HL is a lytic cytotoxin secreted by Staphylococcus aureus, a common and potentially deadly human pathogen (Menestrina et al. 2001). HL is related in amino acid sequence and biological function to a host of other pore-forming Staphylococcal toxins that include a family of bicomponent toxins requiring two subunits for assembly and function (Gouaux et al. 1997). The bicomponent toxins are -hemolysin (HL), leukocidin (Luk), and Panton-Valentine leukocidin (PVL), and are composed of the subunits LukF + HII, LukF + LukS, and PV-LukF + PV-LukS, respectively (Tomita and Kamio 1997). In addition to being similar to HL in terms of function and amino acid sequence, LukF, LukS, and HII are related in three-dimensional structure (Gouaux et al. 1997; Gouaux 1998). All of these Staphylococcal toxins are secreted as water-soluble monomers, and assemble on target cell membranes to form oligomeric membrane pores. HL is a homoheptamer and assembles on erythrocyte and egg phosphatidylcholine membranes, and in deoxycholate micelles (Bhakdi et al. 1981; Gouaux et al. 1994; Song et al. 1996; Fang et al. 1997; Malghani et al. 1999; Krasilnikov et al. 2000). Under some conditions, however, Shao and colleagues contend that a hexamer may also be formed, as determined by atomic force microscopy (Czajkowsky et al. 1998). At the present time, evidence for the subunit stoichiometry of the bicomponent heteromeric Luk pores suggests that they are either heptameric (Sugawara-Tomita et al. 2002) or octameric (Miles et al. 2002).
A number of different probes have been employed to elucidate the mechanism of toxin assembly for the heptameric HL pore, including (1) proteolytic susceptibility (Palmer et al. 1993; Walker et al. 1995), (2) site-directed mutagenesis (e.g., Walker and Bayley 1995a), and (3) fluorescence spectroscopy (Valeva et al. 1997a, b; Vécsey-Semjén et al. 1997). The most parsimonious mechanism for HL assembly is shown below.
 |
 |
Structural studies of the water-soluble monomer (1) and the heptameric pore (7) have shown that there are significant conformational changes between 1 and 7 (Olson et al. 1999; Pédelacq et al. 1999, 2000). In 1, the amino latch and the pre-stem domain are located adjacent to the ß-sandwich domain and participate in intraprotomer interactions (Walker et al. 1992; Walker and Bayley 1995a; Valeva et al. 1997b). In 7, however, the amino latch is directed toward the lumen of the pore, and makes a number of significant contacts with residues on a neighboring protomer (Song et al. 1996). The pre-stem domain has also rearranged in 7 and now forms a transmembrane ß-barrel, called the stem domain. Although the atomic structure for the end point on the assembly pathway has been solved (Song et al. 1996), and a number of key residues that play essential roles in the assembly process have been found, determination of molecular mechanisms for the assembly of the heptamer and for the formation and insertion of the transmembrane ß-barrel have proven elusive.
To elaborate a detailed mechanism for the assembly of HL, we must have structural information on assembly intermediates. However, because the intermediates are inherently short-lived, one must find methods to arrest the toxin at specific points along the assembly pathway. Although a number of toxin variants have been produced that are arrested at intermediate stages of assembly (Walker and Bayley 1995b; Walker et al. 1995; Valeva et al. 2001), variants that can be turned on and off with a switch that is as stereospecific as a disulfide bond are particularly attractive for mechanistic studies (Harrison and Sternberg 1996). In this study, we created double cysteine mutants of HL that are predicted to form disulfide bonds between the ß-sandwich domain and the pre-stem domain. When the cysteine residues form a disulfide bond, the pre-stem will be prevented from rearranging, and the toxin should be inactive. In the presence of a reducing agent, however, the disulfide bond will be reduced, the pre-stem will be able to rearrange, and the toxin should have hemolytic activity. Depending on where the disulfide bond is located, we can halt specific conformational rearrangements. Here, we describe the functional behavior of a panel of four double cysteine mutants, show that rearrangement of the pre-stem is essential for lytic activity and for formation of the SDS-stable heptamer, and demonstrate that formation of the oligomeric prepore intermediate precedes and is not dependent upon rearrangement of the pre-stem.
|
Results |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
–C distances between the pre-stem domain and the ß-sandwich domain of ~5 Å in the monomeric state, (2) appropriate orientation of the C–Cß bond vectors (Harrison and Sternberg 1996) in the monomeric state, and (3) an increase in the C–C separation of the selected residues by more than 10 Å upon heptamer formation. The resulting mutants were HL-A (D108C/K154C), HL-B (M113C/K147C), and HL-C (H48C/N121C), and the locations of the sites are illustrated in Figure 1
. In addition, we made a fourth mutant, HL-D (I5C/G130C), because Valeva and colleagues have shown that introduction of cysteine residues at these positions results in disulfide bond formation between the N-terminus and the ß-sandwich domain, thereby preventing pore formation and cell lysis (Valeva et al. 2001).
|
HL-His6] as a template. The resulting mutant proteins were expressed in the cytoplasm of Escherichia coli cells (Prinz et al. 1997) and purified to homogeneity by affinity chromatography, as shown in Figure 2. The molecular masses were confirmed by mass spectrometry (calculated and predicted masses were, respectively: A, 34.832 and 34.847 kD; B, 34.816 and 34.839 kD; C, 34.824 and 34.845 kD; D, 34.905 and 34.931 kD). As illustrated in Figure 2, in the absence of a reducing agent, HL-A, HL-C and a fraction of HL-D migrated faster than WT-His6, implying that disulfide bonds might have formed, resulting in a more compact protein that migrates faster on the gel. In the presence of a reducing agent, by contrast, the mutants and the wild-type protein comigrated. The mobility of HL-B relative to the WT protein did not change in the presence or absence of a reducing agent.
|
Hemolytic assays of the mutant and wild-type proteins
If the mutant proteins form disulfide bonds and become trapped at an intermediate stage of assembly, they will not have hemolytic activity in the absence of a reducing agent but will have hemolytic activity in the presence of a reducing agent. To test for hemolytic activity, the mutant proteins were incubated with rabbit blood cells (RBC), with and without a reducing agent, and the increase of supernatant absorbance at 475 nm due to released hemoglobin was followed (Fig. 3). In the absence of a reducing agent, HL-A showed background hemolytic activity that was the same as that of buffer only (10%), suggesting that HL-A forms a disulfide bond and does not assemble to a lytic pore. The relatively low hemolytic activity of HL-C (25%) also indicates that a large proportion of HL-C may form disulfide bonds, thus blocking pore formation. For HL-A and HL-C, a reducing agent rescued their hemolytic activity to levels close to that of WT-His6 (95%–100%), suggesting that the introduced cysteine residues do not substantially disrupt their structures.
|
HL-D also showed a high hemolytic activity in the presence of a reducing agent (85%), it also showed substantial activity (60%) in the absence of a reducing agent, suggesting that only a portion of the HL-D mutant protein forms a disulfide bond. In contrast to the other mutants, HL-B showed similar hemolytic activities in the presence or absence of a reducing agent (70%), indicating that HL-B probably does not readily form a disulfide bond. Because HL-A showed the most distinct hemolytic behavior in the presence and absence of a reducing agent, and because the protein expression level of HL-A was at least 10-fold greater than any of the other proteins, including the wild-type toxin, we decided to concentrate our studies on HL-A.
Time course of hemolysis and binding assay of HL-A
To further explore the hemolytic potency of HL-A, a hemolytic assay was carried out with the time course over the first 10 min. Although HL-A did not have hemolytic activity in the absence of a reducing agent, HL-A showed an equivalent hemolytic curve to that of the wild-type protein in the presence of a reducing agent (Fig. 4A). These data strongly suggest that HL-A retains wild-type structure under reducing conditions, resulting in essentially the same hemolytic potency as the wild-type protein. However, HL-A might have a lower hemolytic activity but a higher affinity to rabbit blood cells (RBC), compared to that of the wild-type protein. If this were the case, HL-A might then show hemolytic activity similar to that of the wild-type protein. Therefore, we examined the binding of HL-A to RBC. After incubation of the wild-type toxin and HL-A with RBC on ice, a condition in which HL does not assemble but does bind to RBC (Hildebrand et al. 1991), the supernatant and pellet fractions were analyzed by Western blotting. As shown in Figure 4B, there was no substantial difference between HL-A and wild-type toxin in binding to RBC. Moreover, HL-A binds to RBC to the same extent in the presence or absence of a reducing agent.
|
HL-A forms a disulfide bondHL-A forms a disulfide bond, a limited trypsin digestion assay was performed. Because there are two major trypsin cleavage sites in HL (Fig. 5A), when the wild-type monomeric toxin is treated with a low concentration of trypsin, the resulting digestion yields four major bands including uncut material (35 kD) and three smaller fragments of 34.2, 20.5, and 13.7 kD. One cleavage site is near the amino terminus at Lys 8, and the second site is located in the middle of the sequence at Lys 131. Therefore, if HL-A forms a disulfide bond between the residues C108 and C154 as we predict, the 20.5-kD fragment and the 13.7-kD fragment will remain linked together in the absence of a reducing agent. As shown in Figure 5B, neither the 20.5-kD nor the 13.7-kD fragments are seen under conditions that maintain the integrity of a disulfide bond (lanes 3–6). Digestion is occurring because we see the appearance of the 34.2-kD fragment, as well as a slightly larger ~36-kD fragment as the trypsin concentration increases (lanes 4–6). The approximate yield of these fragments at the highest trypsin concentration (trypsin/protein ratio of 1/50) were ~30% (34.2 kD) and ~20% (~36 kD), respectively. The ~36-kD band may represent a species that is cleaved at Lys 131 but remains intact and has a less compact structure compared to the uncut protein. In the presence of a reducing agent, both the 20.5- and the 13.7-kD bands are produced (lanes 8–11) and the ~36-kD band is not seen. These results suggest that there is a disulfide bond between residues C108 and C154 in HL-A, and that this bond covalently links the amino and carboxyl terminal fragments following cleavage at Lys 131 by trypsin. All fragment sizes were confirmed by mass spectrometry (data not shown).
|
HL-A forms an oligomer in the presence of lipid-like micellesHL-A does not have hemolytic activity under oxidizing conditions but is hemolytic under reducing conditions. To test whether HL-A is trapped as a monomer or oligomer in the absence of a reducing agent but in the presence of lipids, the mutant protein was incubated with DiC8PC micelles and analyzed by SDS-PAGE (Fig. 6). Like deoxycholate (Bhakdi et al. 1981), DiC8PC micelles readily promote the assembly of HL (Southall 1997). In the presence of a reducing agent, HL-A oligomerized like WT-His6 (Fig. 6, right side of gel). Because the oligomer band size of HL-A comigrates with the WT-His6 oligomer band, we assert that HL-A forms a heptamer. However, in the absence of a reducing agent but in the presence of DiC8PC, there is no oligomer band for HL-A lane (Fig. 6, left side of gel). These results indicate that HL-A does not assemble to form a SDS-stable oligomer in the absence of a reducing agent. Nevertheless, HL-A may assemble on a membrane but the assembled oligomer may be SDS-sensitive.
|
HL-A assembles into a SDS-sensitive oligomer on a membrane without a reducing agent, HL-A was crosslinked using glutaraldehyde (Peters and Richards 1977) and analyzed by SDS-PAGE. When HL-A was incubated with the cross-linker in the absence of DiC8PC, there was no band corresponding to the HL-A oligomer, with or without the cross-linker. In the presence of a reducing agent and DiC8PC, HL-A formed an oligomer and the assembly was not dependent upon the presence of a cross-linker (Fig. 7 B, lanes 8–11 and 13–15), which is consistent with our previous results as shown in Figure 6
. In the absence of a reducing agent, however, the detection of an assembled HL-A oligomer was dependent upon the presence of the cross-linker (Fig. 7A, lanes 8–11, 13–16). These results suggest that HL-A assembles into a SDS-sensitive oligomer on a membrane, even in the absence of a reducing agent. Upon assembly under reducing conditions, there are two major bands on the gel at high molecular weight (Fig. 7, lanes 8–11 and 13–15), which may correspond to either the same stoichiometry of oligomer trapped in two conformational states or to oligomers of different subunit stoichiometry.
|
|
Discussion |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
HL assembly intermediates. The idea was to find double cysteine mutants that formed a stable disulfide bond between the ß-sandwich and the pre-stem domains, and prevented assembly and membrane insertion under oxidizing conditions while allowing wild-type like assembly and pore formation under reducing conditions. Because disulfide bonds have specific stereochemical requirements (Harrison and Sternberg 1996), we investigated the behavior of a number of mutants in an effort to select the one(s) that possessed the most favorable properties.
Among the four mutant proteins, we focused our research on HL-A because it is inactive under oxidizing conditions and fully active under reducing conditions. The mutation sites in HL-A are located between the ß-sandwich domain and the neck of the pre-stem domain in the 1 form (Fig. 1A). The pre-stem domain is probably quite flexible in the water-soluble state, not only because it contains numerous glycine residues and is protease sensitive, but also because it undergoes a dramatic rearrangement in the transition from 1 to 7. Because HL-A has wild-type hemolytic potency in the presence of a reducing agent, the loss of hemolytic activity does not result from the disulfide bond simply disrupting the native structure in a nonspecific manner. Therefore, we conclude that the disulfide bond in HL-A specifically connects the ß-sandwich domain and the pre-stem domain, restraining the pre-stem and preventing assembly (Fig. 8).
|
HL-A is arrested. The oligomerization assay showed that there was no oligomer band seen in the HL-A lane in the absence of a reducing agent, indicating that either HL-A does not form an oligomer or HL-A forms an oligomer that is SDS-sensitive. To differentiate between these two possibilities, we cross-linked HL-A with glutaraldehyde in the presence of DiC8PC micelles, conditions that allow for the assembly of the wild-type toxin (Southall 1997). As shown in Figure 7, oligomer bands were seen in the absence of a reducing agent but in the presence of a cross-linker, suggesting that HL-A forms an oligomer on the membrane-like micelles (Fig. 7A; lanes 10–12, 15, and 16). When HL-A was incubated with DiC8PC in the presence of a reducing agent, two major oligomer bands were seen in the presence or absence of a cross-linker (Fig. 7B; lanes 8–11, 13–15). These two different migration patterns may represent different conformational states, that is, the heptameric transmembrane pore and the heptameric prepore, or they may represent different oligomerization states, that is, heptamer versus octamer, for example. In the case of the I5C/G130C double mutant, Bhakdi and colleagues also found that under oxidizing conditions the oligomer migrated more slowly than under reducing conditions (Valeva et al. 2001). In the absence of a reducing agent, on the other hand, there was only one major oligomer band, which corresponds to the slower moving band, suggesting that HL-A does not form a membrane pore but does form an oligomeric prepore. Therefore, our results support the idea that oligomerization precedes pore formation, and that HL-A is arrested at the heptameric prepore (7*) stage of membrane pore formation.
Efforts to conclusively determine whether HL-A forms a heptamer in the absence of reducing agents but in the presence of a cross-linker have not been definitive. We attempted to obtain the molecular weight of the cross-linked species by mass spectrometry, but have not been able to observe species of such high molecular weight in the spectrometer. Estimation of the size of the complex in DiC8PC micelles by SEC has also been inconclusive. Indeed, determining the molecular mass of oligomeric membrane proteins that are in the 200–300-kD range is challenging, particularly for species that have been subject to chemical cross-linking. Nevertheless, one important observation that strongly indicates a specific complex is being cross-linked is that the cross-linking gels show primarily a single major band of mass corresponding approximately to a heptamer. The gels do not show a ladder of bands that would indicate the successive cross-linking of the monomer, dimer, trimer, etc. One would expect to see such a ladder of bands if the HL-A protein were monomeric and simply forming transient, nonspecific contacts with other toxin molecules on the surface of the DiC8PC micelles.
In conclusion, we created and screened four double cysteine mutants to isolate an assembly intermediate of HL. The HL-A mutant is remarkably stable, and is expressed at a level at least 10-fold greater than that of the wild-type protein. The hemolytic and trypsin digestion analysis showed that HL-A forms a disulfide bond between C108 and C154, and this disulfide bond prevents the toxin from forming a transmembrane pore. Furthermore, the cross-linking analysis showed that HL-A assembles on a membrane into an oligomer, which is likely a heptamer, in the absence of a reducing agent, suggesting that HL-A is halted at a heptameric prepore (7*) state. Therefore, conformational rearrangements at positions 108 and 154 are critical to the completion of the assembly of HL but are not essential for membrane binding or for formation of an oligomeric prepore intermediate.
|
Materials and methods |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
HL-A 1st mutation forward), CCAAGAAATTCGATTTGCACAAAAGAG; A1R (HL-A first mutation reverse), CTCTTTTGTGCAAATCG AATTTCTTGG; A2F, CTGATTTCTGCACAATTTTAGAGAG CCC; A2R, GGCTCTCTAAAATTGTGCAGAAATCAGG; B1F, GATACAAAAGAGTATTGCAGTACTTTAACTTATGG; B1R, CCATAAGTTAAAGTA CTGCAATACTCTTTTGTATC; B2F, GGTCATACACTGTGCTATGTTCAACCTG; B2R, CAGGTT GAACATAGCACAGTGTATGACC; C1F, CGATGATAAAA ATTGCAATAAAAAACTGC; C1 R, GC AGTTTTTTATTG CAATTTTTATCATCG; C2F, CTTATGGATTCTGCGGTAAT GTTACTGGTG; C2R, CACCAGTAACATTACCGCAGAATC CATAAG; D1F, GGCAGATTCTGATTGCAATATTAAAAC CGG; D1R, CCGGTTTTAATATTGCAATCAGAATCTGCC; D2F, CTGGTGATGATACATGCAAAATTGGCGGCC; D2R, GGCCGCCAATTTTGCATGTATCATCACCAG.
Mutant DNA construction
All four double-cysteine mutants were made by Quickchange Site-Directed Mutagenesis (Stratagene). The first PCR was carried out for 18 cycles (95°C/30 sec, 50°C/1 min, 68°C/10 min) with 10 ng of pT7[HL-His6] (His-tagged, wild-type HL; generously provided by Hagan Bayley) as the template, 125 ng of primers (A1F/A1R, B1F/B1R, C1F/C1R, D1F/D1R), 1 µL of dNTPs (25 mM), 5 µL of 10x buffer, 40 µL of H2O, and 1 µL of PFU polymerase. The resulting single-cysteine mutants were confirmed by DNA sequencing through the whole HL coding region and used as the template for the second PCR. The second PCR was carried out with the second sets of primers (A2F/A2R, B2F/B2R, C2F/C2R, D2F/D2R) for 18 cycles of 95°C/30 sec, 52°C/1 min, and 68°C/10 min. The entire HL coding region of each double-cysteine mutant was confirmed by DNA sequencing.
Mutant protein purification
Mutant plasmids and pT7[HL-His6] were separately transformed into Origami cells (Novagen; Prinz et al. 1997) and cultured at 37°C for 16–18 h in 40 mL of Luria-Bertani (LB) media containing 15 µg/mL of kanamycin, 50 µg/mL of ampicillin, and 12.5 µg/mL of tetracycline (LB KAT). Two liters of LB KAT were inoculated with the overnight culture and grown at 37°C for about 4 h until the OD600 reached 0.5. The temperature was then shifted to 20°C, and expression was induced with 0.1 mM isopropyl-ß-D-thiogalactoside (IPTG). After 6 h of induction, cells were harvested by centrifugation at 4000 rpm for 20 min and resuspended in 30 mL of ice-cold lysis buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM PMSF, 0.5 mM MgSO4, 0.25 mg/mL lysozyme, 25 µg/mL DNaseI). Cells were broken using a cell disrupter (Avestin), and the soluble fraction was collected by centrifugation at 45,000 rpm at 4°C for 45 min with a Ti-45 rotor. Following filtration through a 0.2-µm filter (Millipore), the soluble fraction was loaded onto a Ni-NTA column (5 mL, Amersham Pharmacia Biotech) at 4°C. After washing with 150 mL of Buffer A (50 mM Tris-Cl pH 8.0, 200 mM NaCl, 1 mM glutamate, 5 mM methionine), recombinant proteins were eluted with a gradient of 300 mM imidazole in Buffer A. Protein containing fractions (110–140 mM imidazole) were dialyzed against size-exclusion chromatography (SEC) buffer (20 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM EDTA) overnight, concentrated to 0.5 mg/mL (estimated from OD280, 
= 63,500) using a Centricon YM10 (Amicon) and stored at -80°C.
SEC analysis
Recombinant proteins were concentrated to 1 mg/mL using a Microcon YM10 (Amicon) and 200 µL were loaded onto a Superose 12 10/30 column (Amersham Pharmacia Biotech) equilibrated with SEC Buffer at 4°C. A constant flow rate (0.5 mL/min) was used, and the elution patterns were detected by the absorbance at 280 nm.
Limited trypsin digestion
Trypsin digestion reactions (100 µL) were carried out by mixing 0.5 mg/mL of recombinant protein in SEC buffer (20 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM EDTA) with a final concentration of 11 mM CaCl2 and trypsin/protein ratios of 0, 1/5000, 1/500, 1/250, 1/50 (w/w) at room temperature (rt) for 40 min. To stop the reactions, phenylmethylsulfonyl fluoride (PMSF) and EDTA were added to final concentrations of 1.5 and 20 mM, respectively, and the reactions were incubated for another 5 min at rt. The reaction mixtures were separated into two fractions (50 µL each) and mixed with 12.5 µL of 4x SDS sample loading buffer +/- 0.7 M ß-mercaptoethanol. The digestions were analyzed by SDS-PAGE.
Hemolysis assays
Recombinant proteins (0.5 mg/mL) were pretreated with 10 mM dithiothreitol (DTT) in hemolysis (HL) buffer (20 mM KH2PO4 pH 7.4, 150 mM NaCl, 1 mg/mL bovine serum albumin) or with a reducing agent-free buffer at rt for 5 min. Hemolysis reactions were then carried out by mixing 20 µL of recombinant protein and 500 µL of rabbit blood cells (RBC; Animal Technologies, Inc) diluted in HL buffer to 12.5% (v/v) with or without 10 mM DTT at 20°C for 20 min (Fig. 3) or 0, 2, 4, 6, 8, and 10 min (Fig. 4A). The reaction mixture was then centrifuged at 13,200 rpm (Eppendorf centrifuge 5415D) for 5 min, and the absorbance at 475 nm of the supernatant was measured spectrophotometrically.
Binding assay
Wild-type and HL-A recombinant protein (0.5 mg/mL) were pretreated with 10 mM DTT in HL buffer or with a reducing agent-free buffer at rt for 5 min. The protein solution (20 µL) was then mixed with 200 µL of RBC diluted in HL buffer to 10% (v/v) with or without 10 mM DTT. The reaction mixture was incubated on ice for 1 h and centrifuged at 13,200 rpm (Eppendorf centrifuge 5415D) for 5 min at 4°C to separate the supernatant and pellet fractions. The resulting supernatant fraction was mixed with 35 µL of 6x SDS sample loading buffer, and the pellet fraction was resuspended in 40 µL of 1x SDS sample loading buffer. The amount of HL was detected by Western blotting using anti penta-His antibody.
Oligomerization assays
Oligomerization reaction mixtures (100 µL) contained 8 mM dioctanoyl phosphatidylcholine (DiC8PC) and 0.5 mg/mL recombinant protein pretreated either with 10 mM DTT in SEC buffer (20 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM EDTA) or with a reducing agent-free buffer at rt for 5 min. The reaction mixtures were incubated at rt for 1 h with stirring and were then mixed with 40 µL of 4x SDS sample loading buffer with or without 0.7 M ß-mercaptoethanol. The oligomerization reactions were detected by SDS-PAGE.
Cross-linking assays
The HL-A mutant was dialyzed against cross-linking (XL) buffer (20 mM sodium phosphate pH 8.0, 150 mM NaCl) three times and pretreated with 10 mM DTT in XL buffer or with a reducing agent-free buffer at rt for 5 min. HL-A (1 mg/mL) was then incubated with or without 8 mM DiC8PC at rt for 1 h to allow for oligomer formation. The resulting reaction mixture (50 µL) was incubated with 50 µL of glutaraldehyde diluted in XL buffer (final concentrations: 0, 0.25, 0.5, 2.5, and 25 µM) at rt for either 1 h or 24 h. SDS-PAGE was carried out to detect crosslinked HL-A.
|
Acknowledgments |
|---|
HL-His6] plasmid. This work was supported by a grant from the NIH. E.G. is an assistant investigator with the Howard Hughes Medical Institute. The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
|
References |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
-toxin: Oligomerization of hydrophilic monomers to form amphiphilic hexamers induced through contact with deoxycholate detergent micelles. Proc. Natl. Acad. Sci. 78: 5475–5479.Booth, P.J., Templer, R.H., Meijberg, W., Allen, S.J., Curran, A.R., and Lorch, M. 2001. In vitro studies of membrane protein folding. Crit. Rev. Biochem. Mol. Biol. 36: 501–603.[CrossRef][Medline]
Czajkowsky, D.M., Sheng, S., and Shao, Z. 1998. Staphylococcal -hemolysin can form hexamers in phospholipid bilayers. J. Mol. Biol. 276: 325–330.[CrossRef][Medline]
Falke, J.J. and Koshland, D.E. 1987. Global flexibility in a sensory receptor: A site-directed cross-linking approach. Science 237: 1596–1600.
Fang, Y., Cheley, S., Bayley, H., and Yang, J. 1997. The heptameric prepore of a Staphylococcal -hemolysin mutant in lipid bilayers imaged by atomic force microscopy. Biochemistry 36: 9518–9522.[CrossRef][Medline]
Gouaux, E. 1998. -Hemolysin from Staphylococcus aureus: An archetype of ß-barrel, channel-forming toxins. J. Struct. Biol. 121: 110–122.[CrossRef][Medline]
Gouaux, E., Hobaugh, M.R., and Song, L. 1997. -Hemolysin, -hemolysin and leukocidin from Staphylococcal aureus: Distant in sequence but similar in structure. Protein Sci. 6: 2631–2635.[Abstract]
Gouaux, J.E., Braha, O., Hobaugh, M.R., Song, L., Cheley, S., Shustak, C., and Bayley, H. 1994. Subunit stoichiometry of staphylococcal -hemolysin in crystals and on membranes: A heptameric transmembrane pore. Proc. Natl. Acad. Sci. 91: 12828–12831.
Guex, N. and Peitsch, M.C. 1997. SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modeling. Electrophoresis 18: 2714–2723.[CrossRef][Medline]
Harrison, P.M. and Sternberg, M.J. 1996. The disulphide ß-cross: From cystine geometry and clustering to classification of small disulphide-rich protein folds. J. Mol. Biol. 264: 603–623.[CrossRef][Medline]
Heuck, A.P., Tweten, R.K., and Johnson, A.E. 2001. ß-barrel pore-forming toxins: Intriguing dimorphic proteins. Biochemistry 40: 9065–9073.[CrossRef][Medline]
Hildebrand, A., Pohl, M., and Bhakdi, S. 1991. Staphylococcus aureus -toxin. Dual mechanism of binding to target cells. J. Biol. Chem. 266: 17195–17200.
Hotze, E.M., Wilson-Kubalek, E.M., Rossjohn, J., Parker, M.W., Johnson, A.E., and Tweten, R.K. 2001. Arresting pore formation of a cholesterol-dependent cytolysin by disulfide trapping synchronizes the insertion of the transmembrane ß-sheet from a prepore intermediate. J. Biol. Chem. 276: 8261–8268.
Krasilnikov, O.V., Merzlyak, P.G., Yuldasheva, L.N., Rodrigues, C.G., Bhakdi, S., and Valeva, A. 2000. Electrophysiological evidence for heptameric stoichiometry of ion channels formed by Staphylococcus aureus -toxin in planar lipid bilayers. Mol. Microbiol. 37: 1372–1378.[CrossRef][Medline]
Malghani, M.S., Fang, Y., Cheley, S., Bayley, H., and Yang, J. 1999. Heptameric structures of two -hemolysin mutants imaged with in situ atomic force microscopy. Micros. Res. Technol. 44: 353–356.
Matsumura, M. and Matthews, B.W. 1989. Control of enzyme activity by an engineered disulfide bond. Science 243: 792–794.
Menestrina, G., Serra, M.D., and Prevost, G. 2001. Mode of action of ß-barrel pore-forming toxins of the staphyloccal -hemolysin family. Toxicon 39: 1661–1672.[Medline]
Miles, G., Movileanu, L., and Bayley, H. 2002. Subunit composition of a bicomponent toxin: Staphylococcal leukocidin forms an octameric transmembrane pore. Protein Sci. 11: 894–902.
Montoya, M. and Gouaux, E. 2003. ß-Barrel membrane protein folding and structure viewed through the lens of -hemolysin. Biochem. Biophys. Acta 1609: 19–27.[Medline]
Olson, R., Nariya, H., Yokota, K., Kamio, Y., and Gouaux, E. 1999. Crystal structure of Staphylococcal LukF delineates conformational changes accompanying formation of a transmembrane channel. Nat. Struct. Biol. 6: 134–140.[CrossRef][Medline]
Palmer, M., Weller, U., Messner, M., and Bhakdi, S. 1993. Altered pore-forming properties of proteolytically nicked staphylococcal -toxin. J. Biol. Chem. 268: 11963–11967.
Pédelacq, J.-D., Maveyraud, L., Prévost, G., Baba-Moussa, L., González, A., Courcelle, E., Shepard, W., Monteil, H., Samama, J.-P., and Mourey, L. 1999. The structure of a Staphylococcus aureus leucocidin component (LukF-PV) reveals the fold of the water-soluble species of a family of transmembrane pore-forming toxins. Structure 7: 277–287.[Medline]
Pédelacq, J.D., Prevost, G., Monteil, H., Mourey, L., and Samana, J.P. 2000. Crystal structure of the F component of the Panton-Valentine leucocidin. Int J. Med. Microbiol. 290: 395–401.[Medline]
Peitsch, M.C. 1996. ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochem. Soc. Trans. 24: 274–279.[Medline]
Peitsch, M.C. and Tschopp, J. 1995. Comparative molecular modelling of the Fas-ligand and other members of the TNF family. Mol. Immunol. 32: 761–772.[CrossRef][Medline]
Peters, K. and Richards, F.M. 1977. Chemical cross-linking: Reagents and problems in studies of membrane structure. Annu. Rev. Biochem. 46: 523–551.[CrossRef][Medline]
Prevost, G., Mourey, L., Colin, D.A., and Menestrina, G. 2001. Staphylococcal pore-forming toxins. Curr. Top. Microbiol. Immunol. 257: 53–83.[Medline]
Prinz, W.A., Aslund, F., Holmgren, A., and Beckwith, J. 1997. The role of the thioredoxin and glutaredoxin pathways in reducing protein disulfide bonds in Escherichia coli cytoplasm. J. Biol. Chem. 272: 15661–15667.
Rossjohn, J., Raja, S.M., Nelson, K.L., Feil, S.C., van der Goot, F.G., Parker, M.W., and Buckley, J.T. 1998. Movement of a loop in domain 3 of aerolysin is required for channel formation. Biochemistry 37: 741–746.[CrossRef][Medline]
Song, L., Hobaugh, M.R., Shustak, C., Cheley, S., Bayley, H., and Gouaux, J.E. 1996. Structure of Staphyloccal -hemolysin, a heptameric transmembrane pore. Science 274: 1859–1866.
Southall, N.T. 1997. Phosphatidyl choline micelle catalysis of staphylococcal -hemolysin. MS. thesis, University of Chicago, Chicago, IL.
Sugawara-Tomita, N., Tomita, T., and Kamio, Y. 2002. Stochastic assembly of two-component Staphylococcal -hemolysin into heteroheptameric transmembrane pores with alternate subunit arrangements in ratios of 3:4 and 4:3. J. Bacteriol. 184: 4747–4756.
Tomita, T. and Kamio, Y. 1997. Molecular biology of pore-forming cytolysins from Staphylococcus aureus, - and -hemolysins and leukocidin. Biosci. Biotechnol. Biochem. 61: 565–572.[Medline]
Valeva, A., Palmer, M., and Bhakdi, S. 1997a. Staphylococcal -toxin: Formation of the heptameric pore is partially cooperative and proceeds through multiple intermediate stages. Biochemistry 36: 13298–13304.[CrossRef][Medline]
Valeva, A., Pongs, J., Bhakdi, S., and Palmer, M. 1997b. Staphylococcal -toxin: The role of the N-terminus in formation of the heptameric pore—A fluorescence study. Biochim. Biophys. Acta 1325: 281–286.[Medline]
Valeva, A., Schnabel, R., Walev, I., Boukhallouk, F., Bhakdi, S., and Palmer, M. 2001. Membrane insertion of the heptameric staphyloccal -toxin pore. A domino-like structural transition that is allosterically modulated by the target cell membrane. J. Biol. Chem. 276: 14835–14841.
Vécsey-Semjén, B., Lesieur, C., Möllby, R., and van der Goot, F.G. 1997. Conformational changes due to membrane binding and channel formation by Staphylococcal -toxin. J. Biol. Chem. 272: 5709–5717.
Walker, B. and Bayley, H. 1995a. Key residues for membrane binding, oligomerization, and pore forming activity of Staphylococcal -hemolysin identified by cysteine scanning mutagenesis and targeted chemical modification. J. Biol. Chem. 270: 23065–23071.
———. 1995b. Restoration of pore-forming activity in staphylococcal -hemolysin by targeted covalent modification. Protein Eng. 8: 491–495.
Walker, B., Krishnasastry, M., Zorn, L., and Bayley, H. 1992. Assembly of the oligomeric membrane pore formed by Staphylococcal -hemolysin examined by truncation mutagenesis. J. Biol. Chem. 267: 21782–21786.
Walker, B., Braha, O., Cheley, S., and Bayley, H. 1995. An intermediate in the assembly of a pore-forming protein trapped with a genetically-engineered switch. Chem. Biol. 2: 99–105.[CrossRef][Medline]
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Jayasinghe, G. Miles, and H. Bayley Role of the Amino Latch of Staphylococcal {alpha}-Hemolysin in Pore Formation: A CO-OPERATIVE INTERACTION BETWEEN THE N TERMINUS AND POSITION 217 J. Biol. Chem., January 27, 2006; 281(4): 2195 - 2204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Jayasinghe and H. Bayley The leukocidin pore: Evidence for an octamer with four LukF subunits and four LukS subunits alternating around a central axis Protein Sci., October 1, 2005; 14(10): 2550 - 2561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kristan, Z. Podlesek, V. Hojnik, I. Gutierrez-Aguirre, G. Guncar, D. Turk, J. M. Gonzalez-Manas, J. H. Lakey, P. Macek, and G. Anderluh Pore Formation by Equinatoxin, a Eukaryotic Pore-forming Toxin, Requires a Flexible N-terminal Region and a Stable {beta}-Sandwich J. Biol. Chem., November 5, 2004; 279(45): 46509 - 46517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schultz-Heienbrok, T. Maier, and N. Strater Trapping a 96{degrees} domain rotation in two distinct conformations by engineered disulfide bridges Protein Sci., July 1, 2004; 13(7): 1811 - 1822. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||
