|
|
||||||||
1 subunit AMP allosteric regulatory site
1 St. Vincents Institute of Medical Research, Fitzroy, Victoria 3065, Australia
2 Departments of Medicine and Biochemistry, Dartmouth Medical School, and Department of Biological Sciences, Dartmouth College, Hanover, New Hampshire 03755, USA
Reprint requests to: Bruce E. Kemp, St. Vincents Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065, Australia; e-mail: kemp{at}ariel.unimelb.edu.au; fax: 61-3-94162676.
(RECEIVED July 20, 2003; FINAL REVISION September 12, 2003; ACCEPTED September 12, 2003)
3 These authors contributed equally to this work. ![]()
Article and publication are at http://www.proteinscience.org/cgi/doi/10.1110/ps.03340004.
| Abstract |
|---|
|
|
|---|
ß
heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the
subunit and by AMP allosteric control previously thought to be mediated by both
and
subunits. Here we present evidence that adjacent
subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the
1 CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast
homolog, snf4 contains a His151Gly substitution, and when this is introduced into
1, AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in
1 corresponds to the site of mutation in human
2 and pig
3 genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the
and
subunits and that AMP functions to derepress AMPK activity.
Keywords: AMPK; AMP; CBS sequences;
subunit; allosteric and intrasteric control
| Introduction |
|---|
|
|
|---|
, cholesterol synthesis by phosphorylation of HMG-CoA reductase, triglyceride synthesis by phosphorylation of GPAT (glycerol-phosphate acyl transferase), and hormone-sensitive lipase (Hardie and Hawley 2001). In many cell types AMPK regulates ß-oxidation of fatty acids by phosphorylation of acetyl CoA carboxylase-ß. Furthermore, AMPK exerts powerful transcriptional control of genes involved in lipid and carbohydrate metabolism (Zhou et al. 2000; Leclerc et al. 2001; Lo et al. 2001; Zheng et al. 2001; Barthel et al. 2002; Kawaguchi et al. 2002; Stoppani et al. 2002; Ferre et al. 2003; Kemp et al. 2003; Leff 2003). AMPK can also be activated by several adipocyte-derived hormones, including adiponectin (Yamauchi et al. 2002) and leptin (Minokoshi et al. 2002), as well as by isoproterenol (Moule and Denton 1998). Several drugs, including metformin (Hawley et al. 2002) and rosiglitazone (Fryer et al. 2002), used extensively for the treatment of type II diabetes, activate AMPK, supporting the view that AMPK actions protect the body from developing diabetes. The importance of AMPK in regulating glucose metabolism has been strongly highlighted by the discovery of a series of mutations in the AMPK
subunit genes that cause glycogen storage disease in humans (Blair et al. 2001), pigs (Milan et al. 2000), and yeast (Cannon et al. 1994).
In mammals, AMPK is a
ß
heterotrimer, with each subunit belonging to a larger isoform family comprising
1,
2, ß1, ß2,
1,
2, and
3, exhibiting varying tissue and subcellular expression (Kemp et al. 2003). AMPK activity depends on the presence of the catalytic
subunit as well as the noncatalytic ß and
subunits (Dyck et al. 1996). AMPK is activated by phosphorylation of T172 within the
subunit activation loop (Hawley et al. 1996) by upstream protein kinases (AMPKK) that includes LKB1 (Hong et al. 2003). Once phosphorylated at T172, AMP allosteric binding can further activate AMPK. In resting muscle, AMPK is largely inactive, present in the dephospho T172 form, and following exercise is phosphorylated and activated (Park et al. 2002). Typically, low µM concentrations of AMP are required to activate AMPK. Frederich and Balschi (2002) have shown that half maximal activation of AMPK occurs at approximately 2 µM AMP using a metabolically stressed heart preparation. In addition to AMP acting as a direct allosteric activator of AMPK, it has been reported to activate the upstream AMPKK (Hawley et al. 1995), together with inhibiting T172 dephosphorylation by phosphatases (Davies et al. 1995). In this way the amplified AMP signal is proposed to act as an ultrasensitive detection system for metabolic stress (Hardie et al. 1999). The
subunit isoforms differ in their N-terminal sequences but share the presence of four conserved repeat sequences. These correspond to a pair of repeat sequences found in cystathionine ß-synthase, termed CBS sequences (Bateman 1997; see CBS domain web page at http://www.sanger.ac.uk/Users/agb/CBS/CBS.html), that are important for the allosteric control of cystathionine ß-synthase. Several lines of evidence point to the
subunit as the major site of AMP allosteric control. Photoaffinity labeling studies show AMP binding to the
subunit (Cheung et al. 2000). This has now been extended by direct binding studies by Hardie and colleagues who have shown that each
subunit binds 2 moles of AMP with the CBS1/2 and CBS3/4 pairs each contributing a separate binding site (Scott et al. 2003). A
1 mutation, R70Q, in the first CBS domain, causes a loss of AMP dependence (Hamilton et al. 2001). This is similar to the D444N mutation in the first CBS domain of cystathionine ß-synthase that gives rise to hereditary hyperhomocysteinemia due to a reduction in cystathionine ß-synthase activity and a shift in the doseresponse curve for allosteric activation by S-adenosyl methionine (Kluijtmans et al. 1996; Janosik et al. 2001; Evande et al. 2002).
Several of the mutations in
2 that give rise to familial hypertrophic cardiomyopathy (Wolff-Parkinson-White syndrome; reviewed in Gollob et al. 2002) occur in the CBS sequences. These mutations (R302Q [CBS1], H383R [CBS2], and R351G [CBS4]) have been reported to reduce the level of AMP activation when transiently expressed in CCL13 cells (Daniel and Carling 2002).
Since the crystal structures of several enzymes containing CBS domains have been reported, including bacterial inosine monophosphate dehydrogenase (Zhang et al. 1999), with pairs of CBS sequences forming globular domains, this has allowed us to investigate whether the
subunits contain potential binding sites for AMP related to the classical AMP binding site present in the phosphorylase crystal structure (Sprang et al. 1991). In the present study we show that the
subunits contain prominent and highly conserved binding pockets for AMP formed by pairs of CBS sequences. The juxtaposition of
1 CBS sequences 1 and 2 create a binding pocket comprising Arg70, His151, Arg152, and Arg171, and mutation of any of these critical residues can cause loss of AMP dependence and suppression of AMPK inhibition by ATP.
| Results |
|---|
|
|
|---|
subunit CBS sequences
1 AMP binding subdomain was modeled using the previously identified CBS domain structural motif (Bateman 1997). Several examples of the CBS domains have been structurally characterized. Following review of various sequence alignments and secondary structural predictions (Stultz et al. 1993) the CBS domain structure of inosine monophosphate dehydrogenase from Streptococcus pyogenes (PDB ID: 1ZFJ
[PDB]
; Zhang et al. 1999) was chosen for comparative modeling with AMPK
1. Modeling was performed with the Swiss model WWW server (Peitsch 1996). Only the CBS domain repeats of the peptide sequence were modeled, and no attempt was made to model the connecting loop. The starting model was rebuilt by hand using the program TURBO (http://afmb.cnrs-mrs.fr/), and optimized by molecular dynamics calculation using the program SYBYL (Tripos Inc.). The stereochemical quality of the resulting model was checked with PROCHECK (CCP4 1994), and was found to be of acceptable quality.
Features of the phosphorylase AMP binding site
AMP is an allosteric regulator of both glycogen phosphorylase a and b (Krebs 1954). The phosphorylase a (PDB ID: 1FA9
[PDB]
; Rath et al. 2000) and b (Sprang et al. 1991) structures are therefore suitable candidates for searching the AMP binding site for features that may be shared with AMPK (Fig. 2A
). In phosphorylase a, the AMP binding site residues are present in a surface cleft between two
-helices, helix 2 and helix 10. The AMP binding site is a tertiary structural element formed by both main-chain and side-chain moieties from several secondary structure elements. The binding site is highly positively charged (Fig. 2B
) due to the clustering of four Arg residues at one end of the binding site. Arg193 and Arg242 are held in place by salt bridge interactions with Asp306 and contribute to the surface positive charge. Arg309 and Arg310 each contribute a hydrogen bond to the AMP phosphate oxygen atoms (R309_NH2AMP_PO 2.69 Å, R310_NH1AMP_PO 3.33 Å). Arg309 and Arg310 are also involved in an extensive hydrogen bonding network, back-bonding to the protein core with hydrogen bonds to Tyr157, Tyr83, Asp306, and hydrogen bonds to a number of ordered water molecules. Arg309 an Arg310 also interact directly with each other. The adenosine ring of the AMP is stabilized at the opposite end of the binding cleft by a
-stack interaction with Tyr75 (AMP-Y75_Ph 3.7 Å) (Fig. 2A
).
|
1 subunit model (Fig. 1
1 subunit of AMPK is very much smaller than phosphorylase a, and therefore, the binding pocket on
1 is created by a different secondary structure architecture as well as having differences in surface charge (Fig. 2B,C
1 CBS1/CBS2 domain was more likely, AMP was docked into each site with the program AUTODOCK (Morris et al. 1998) and the results compared. One site was significantly favored over the other, both in docking energy and in clustering of multiple docking runs. In addition to the Arg residues in the AMP binding pocket, Pro73, Met85, His151, Pro154, and Ile156 also make contact with AMP (Figs. 3
|
|
|
The docking energies for AMP were significantly better than those for ATP, indicating that AMP would be expected to have a lower binding constant than ATP. This suggests, as has been previously postulated, that AMP and ATP compete for binding to AMPK (Hardie et al. 1999), with AMP having a much lower off-rate from the binding site. Thus, allosteric upregulation of AMPK activity occurs while AMP is transiently bound and also in the absence of sufficient competing ATP.
The first missense mutation identified in human
2 that causes the Wolf Parkinson White-like syndrome was R302Q (Gollob et al. 2001) in the first CBS domain, which corresponds to the position of R70 in the
1 model structure (Figs. 2C
, 3
) within the AMP binding site pocket. We had previously found that the R70Q mutation in the
1 subunit was strongly activating, resulting in a high level of constitutive AMPK activity and loss of AMP dependence (Hamilton et al. 2001). The presence of R70Q in the AMP binding pocket now explains why there was a loss of AMP dependence. This also provides a reason for the reported reduction in AMP dependence of the corresponding
2 mutants (R302Q, H383R) (Daniel and Carling 2002).
We have now tested the effect of mutating the other two Arg residues in the AMP binding pocket, R152 and R171, to Gln. Wild-type
1 or mutant
1 subunits were transfected into COS-7 cells with a GST-
1 construct and the native ß1 subunit. The expressed AMPK holoenzyme (
1ß1
1) was purified over glutathione beads and the activity of the enzyme measured at varying AMP concentrations. In all cases the presence of the three subunits in the holoenzyme complex was confirmed by SDS-PAGE and immunoblotting with the corresponding
, ß, or
subunit antibodies. The expressed wild type enzyme from COS-7 cells was activated 1.9-fold to approximately 0.5 pmole/min by AMP, with half maximum activation KA0.5 occurring at 10.2 ± 0.6 µM (Table 1
; Fig. 5
). This contrasts with the high KA0.5 values for AMP activation of approximately 77 µM reported for wild-type constructs expressed in CCL13 cells (Daniel and Carling 2002). The R152Q and R171Q
mutations increased constitutive AMPK activity to approximately 9 and 1.1 pmole/min, respectively, and there was complete loss of AMP dependence for the R70Q and R171Q mutants (Fig. 5
). The R152Q mutant retained some AMP dependence with approximately 17% stimulation at 100 µM AMP. The level of activity of the AMPK carrying the R152Q mutation was approximately twice the activity of AMPK with the
1 R70Q mutation (Fig. 5B
; 5 pmole/min). These results show that all three Arg residues present in the AMP modeled binding site influence AMP allosteric control. To test whether substitution of R70 with a less polar residue affected activity we made the R70V mutant. We chose Val because it is present in the yeast homolog of
, Snf4p (Fig. 3
). The presence of Val at position 70 had only a modest effect on AMP dependence increasing it from 10.2 µM to 14.8 µM and reducing the maximum stimulation from 1.9- to 1.6-fold (Table 1
). This indicates that the Gln side chain at position 70 is deleterious for the allosteric control of AMPK rather than a nonspecific structural effect of mutating Arg70. The different Arg to Gln mutations in the AMP binding site resulted in an apparent increase in the maximum AMPK activity (Fig. 4
). In all three cases expression and the level of Thr172 phosphorylation in the activation loop of the
catalytic subunit was higher, as assessed by antiphosphopeptide Thr172 immunoblotting (results not shown). This may indicate that the holoenzyme containing the Arg mutants in the
subunit are better substrates for the AMPKK than the wild-type
subunit containing enzyme, rather than having inherently higher activities.
|
|
2 binds 2 moles of AMP (Scott et al. 2003) and mutation R531G (equivalent to R152 in
1 CBS2) in the CBS4 domain (Gollob et al. 2001) of the
2 subunit, gives rise to the cardiac phenotype.
Several other mutations were made including F51L and F51Y in a region that is outside the predicted AMP binding pocket. The F51L mutation resulted in an approximate twofold increase in the KA0.5 for AMP to 24 µM. In contrast, the F51Y mutation reduced the KA0.5 for AMP to 5.4 µM (Table 1
). These results indicate that mutation outside the AMP binding site can reduce or enhance the AMP binding to the
subunit, but these changes are relatively modest and do not result in the dramatic changes in allosteric control observed when key residues are modified in the binding pocket.
In the phosphorylase a structure the AMP binding pocket contains TyrA75 (Fig. 2A
) in association with the adenine ring. At the base of the AMP binding pocket in the
1 subunit there is a Phe at position 82. We mutated this residue to both Leu and Tyr and found that F82L and F82Y had KA0.5 values for AMP activation of approximately 10 µM, indistinguishable from native
1 (Table 1
). Inspection of the model of the
AMP binding site indicates that the adenine ring may not penetrate sufficiently into the pocket (Fig. 2C,D
) to interact with Phe82 in marked contrast to the AMP site in phosphorylase. In the
1 CBS1/CBS2 model the most prominent contacts between the adenine ring and the pocket side chains are Pro73, Met85, His151, Pro154, and Ile156.
As high concentrations of ATP suppress AMP stimulation of AMPK (Hardie et al. 1999), we compared the effect of increasing concentrations of ATP on both native AMPK and the R152Q mutant that retains some AMP dependence. At 100 µM AMP the wild-type AMPK activity is increased by increasing ATP to a maximum at 500 µM ATP and thereafter declines, as expected from ATP competition at the AMP allosteric site (Fig. 6A,C
). In contrast, the R152Q mutant shows no decrease in AMPK activity with increasing ATP concentration under these conditions (Fig. 6B,D
). These results indicate that mutations of the AMP binding site that weaken AMP allosteric control also suppress the inhibitory properties of ATP. This loss of ATP inhibition may contribute to enhanced activation of the mutants by the AMPK kinase.
|
CBS1/CBS2 and Snf4p (Fig. 3
1 is not sufficient to block AMP allosteric control, and therefore does not explain the Snf1p/Snf4p AMP independence. However, the most prominent difference in the AMP binding site between
1 and Snf4p is a Gly in place of H151 (Fig. 3
1-H151G mutation largely abolished AMP dependence, as shown in Figure 5F| Discussion |
|---|
|
|
|---|
subunit AMP binding site would suppress phosphorylation of T172 by AMPKK. The docking experiments indicate that when ATP is bound, the ß and
phosphates extend out of the AMP binding pocket, and therefore may be available to make intersubunit contacts. One possible mechanism for suppressing AMPK activity would be if the juxtaposition of the
subunit allowed the ATP
phosphate to bridge the
subunit activation loop region and contact with the basic residue cluster that otherwise interact with T172 once it is phosphorylated. This would prevent the correct orientation of the activation loop and suppress phosphorylation of T172 by AMPKK. Once AMP bound the
subunit, the
phosphate contact would be lost and T172 would be readily phosphorylated. However, if ATP reoccupied the allosteric site the
phosphate would compete with the T172 phosphate intramolecular interactions in the catalytic subunit and suppress activity. Such competition by the
phosphate of ATP would also expose T172 phosphate in the activation loop to dephosphorylation by phosphatases. AMP binding at the allosteric site promotes phosphorylation of T172 as well as increasing the activity of the phosphorylated enzyme. Although the
phosphate of ATP bound to the allosteric site causes the disorder of the activation loop and phosphatase attack, equally, AMP would inhibit the dephosphorylation of T172, as has been observed experimentally (Davies et al. 1995). In this model ATP acts as an intrasteric inhibitor by bridging the
and
subunits. Direct binding studies by Hardie and colleagues and the modeling and mutagenesis studies reported here show that a pair of CBS sequences are required to form a functional allosteric binding domain for AMP. Based on the known structure of the pair of CBS sequences in inosine monophosphate dehydrogenase and the role of the domain in allosteric control of both cystanthionine ß synthase and AMPK, it seems likely that they will be responsible for allosteric control across the diversity of proteins where they are found. Accordingly, we propose that these structures be named "Bateman modules" after their founder, Alex Bateman (Bateman 1997).
| Materials and methods |
|---|
|
|
|---|
1 and native-ß1 were used as previously described (Hamilton et al. 2001). A plasmid encoding the full-length human AMPK
1 subunit cDNA cloned in frame with an N-terminal hemagglutinin epitope tag has been previously described (Gao et al. 1996). This plasmid (pMT2-HA-PRKA
1) encoding wild-type (WT)
1 was used as a PCR template to generate amino acid substitutions. Mutations to the
1 coding sequence were performed by PCR using the Quickchange XL site-directed mutagenesis kit (Stratagene) according to the manufacturers instructions. The substitutions generated and the 5' to 3' sequences of the sense strand oligonucleotides used were as follows (base changes underlined), F51L, CCAAATTGGTTGTATTGGATACGTCCCTGCAGG; F51Y,CCAAATTGGTTGTATATGATACGTCCCTGCAGG; R70Q, GTGACTAACGGTGTACAAGCTGCCCCTTTATGG; R70V, GTGACTAACGGTGTAGTAGCTGCCCCTTTATGG; F82L, GTAAGAAGCAAAGTTTAGTGGGCATGCTGACC; F82Y, GTAAGAAGCAAAGTTATGTGGGCATGCTGACC; R152Q, GGAACAAGATCCACCAGCTGCCAGTTATTGACC; R171Q, CACCCACAAGCAGATTCTGAAGTTCC
All mutants were verified by DNA sequencing.
Plasmid DNA used in transfections was purified using a Hi-Speed plasmid purification kit (QIAGEN), and resuspended in endotoxin-free 10 mM TrisHCl, pH 7.5, 1 mM EDTA at 1 µg/µL.
Transfections
COS-7 cells were cultured in 10-cm dishes and maintained in DME plus 10% fetal bovine serum. Transient transfections were performed with FuGENE 6 (Roche) according to the manufacturers instructions. Briefly, 10-cm dishes of COS-7 cells at 70% confluence were triple-transfected with a mixture of 7.5 µL of FuGENE 6 and 1 µg of each of the GST-
1, native-ß1 and native
1 (WT or mutant) constructs. Twenty-four hours posttransfection, the cells were washed with ice-cold phosphate-buffered saline, harvested in a lysis buffer (50 mM TrisHCl, pH7.5, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 50 mM NaF, 5 mM Na Pyrophosphate, 10% Glycerol, 1% Triton X-100, 10 µg/mL Trypsin inhibitor, 2 µg/mL Aprotinin, 1 mM Benzamidine, 1 mM PMSF), and lysed by freeze thawing. The insoluble material was removed by centrifugation and the AMPK holoenzyme was purified by chromatography on Glutathione Sepharose 4B (Amersham Biosciences), followed by elution with 10 mM reduced glutathione. The
1, ß1, and
1 expression levels were assessed by SDS-PAGE of the AMPK, and immunoblotted with affinity purified polyclonal antibodies to each subunit (data not shown).
AMPK assays
Activity of AMPK protein eluted from Glutathione Sepharose 4B column was measured in a reaction containing 50 mM HEPES, pH 7.5, 10 mM MgCl2, 5% Glycerol, 0.05% Triton X-100 with 1 mM DTT, 10 µM SAMS peptide, 0.25 mM [
-32P] ATP (500 cpm/pmole), and varying AMP concentrations as indicated. In AMP/ATP competitive experiments, the AMP and ATP concentrations were as indicated. Reactions were incubated at 30°C for 67 min. An aliquot was applied to P81 paper as previously described to separate the [
-32P] ATP from the phosphorylated peptide (Glass et al. 1978).
| Acknowledgments |
|---|
subunit CBS pairs. The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| References |
|---|
|
|
|---|
Barthel, A., Schmoll, D., Kruger, K.D., Roth, R.A., and Joost, H.G. 2002. Regulation of the forkhead transcription factor FKHR (FOXO1a) by glucose starvation and AICAR, an activator of AMP-activated protein kinase. Endocrinology 143: 31833186.[Abstract]
Bateman, A. 1997. The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem. Sci. 22: 1213.[Medline]
Blair, E., Redwood, C., Ashrafian, H., Oliveira, M., Broxholme, J., Kerr, B., Salmon, A., Ostman-Smith, I., and Watkins, H. 2001. Mutations in the
(2) subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: Evidence for the central role of energy compromise in disease pathogenesis. Hum. Mol. Genet. 10: 12151220.
Cannon, J.F., Pringle, J.R., Fiechter, A., and Khalil, M. 1994. Characterization of glycogen-deficient glc mutants of Saccharomyces cerevisiae. Genetics 136: 485503.[Abstract]
CCP4. 1994. The CCP4 suite: Programs for protein crystallography. Acta Crystallogr. D 50: 760763.[CrossRef][Medline]
Cheung, P.C., Salt, I.P., Davies, S.P., Hardie, D.G., and Carling, D. 2000. Characterization of AMP-activated protein kinase
-subunit isoforms and their role in AMP binding. Biochem. J. 346: 659669.
Daniel, T. and Carling, D. 2002. Functional analysis of mutations in the
2 subunit of AMP-activated protein kinase associated with cardiac hypertrophy and Wolff-Parkinson-White syndrome. J. Biol. Chem. 277: 5101751024.
Davies, S.P., Helps, N.R., Cohen, P.T., and Hardie, D.G. 1995. 5'-AMP inhibits dephosphorylation, as well as promoting phosphorylation, of the AMP-activated protein kinase. Studies using bacterially expressed human protein phosphatase-2C
and native bovine protein phosphatase-2AC. FEBS Lett. 377: 421425.[CrossRef][Medline]
Dyck, J.R.B., Gao, G., Widmer, J., Stapleton, D., Fernandez, C.S., Kemp, B.E., and Witters, L.A. 1996. Regulation of 5'-AMP-activated protein kinase activity by the noncatalytic ß and
subunits. J. Biol. Chem. 271: 1779817803.
Evande, R., Blom, H., Boers, G.H., and Banerjee, R. 2002. Alleviation of intrasteric inhibition by the pathogenic activation domain mutation, D444N, in human cystathionine ß-synthase. Biochemistry 41: 1183211837.[CrossRef][Medline]
Ferre, P., Azzout-Marniche, D., and Foufelle, F. 2003. AMP-activated protein kinase and hepatic genes involved in glucose metabolism. Biochem. Soc. Trans. 31: 220223.[Medline]
Frederich, M. and Balschi, J.A. 2002. The relationship between AMP-activated protein kinase activity and AMP concentration in the isolated perfused rat heart. J. Biol. Chem. 277: 19281932.
Fryer, L.G., Parbu-Patel, A., and Carling, D. 2002. The anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. J. Biol. Chem. 277: 2522625232.
Gao, G., Fernandez, C.S., Stapleton, D., Auster, A.S., Widmer, J., Dyck, J.R., Kemp, B.E., and Witters, L.A. 1996. Non-catalytic ß- and
-subunit isoforms of the 5'-AMP-activated protein kinase. J. Biol. Chem. 271: 86758681.
Glass, D.B., Masaracchia, R.A., Feramisco, J.R., and Kemp, B.E. 1978. Isolation of phosphorylated peptides and proteins on ion exchange papers. Anal. Biochem. 87: 566575.[CrossRef][Medline]
Gollob, M.H., Seger, J.J., Gollob, T.N., Tapscott, T., Gonzales, O., Bachinski, L., and Roberts, R. 2001. Novel PRKAG2 mutation responsible for the genetic syndrome of ventricular preexcitation and conduction system disease with childhood onset and absence of cardiac hypertrophy. Circulation 104: 30303033.
Gollob, M.H., Green, M.S., Tang, A.S., and Roberts, R. 2002. PRKAG2 cardiac syndrome: Familial ventricular preexcitation, conduction system disease, and cardiac hypertrophy. Curr. Opin. Cardiol. 17: 229234.[CrossRef][Medline]
Hamilton, S.R., Stapleton, D., ODonnell Jr., J.B., Kung, J.T., Dalal, S.R., Kemp, B.E., and Witters, L.A. 2001. An activating mutation in the
1 subunit of the AMP-activated protein kinase. FEBS Lett. 500: 163168.[CrossRef][Medline]
Hardie, D.G. and Hawley, S.A. 2001. AMP-activated protein kinase: The energy charge hypothesis revisited. Bioessays 23: 11121119.[CrossRef][Medline]
Hardie, D.G., Salt, I.P., Hawley, S.A., and Davies, S.P. 1999. AMP-activated protein kinase: An ultrasensitive system for monitoring cellular energy charge. Biochem. J. 338: 717722.
Hawley, S.A., Selbert, M.A., Goldstein, E.G., Edelman, A.M., Carling, D., and Hardie, D.G. 1995. 5'-AMP activates the AMP-activated protein kinase cascade, and Ca2+/calmodulin activates the calmodulin-dependent protein kinase I cascade, via three independent mechanisms. J. Biol. Chem. 270: 2718627191.
Hawley, S.A., Davison, M., Woods, A., Davies, S.P., Beri, R.K., Carling, D., and Hardie, D.G. 1996. Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J. Biol. Chem. 271: 2787927887.
Hawley, S.A., Gadalla, A.E., Olsen, G.S., and Hardie, D.G. 2002. The antidiabetic drug metformin activates the AMP-activated protein kinase cascade via an adenine nucleotide-independent mechanism. Diabetes 51: 24202425.
Hong, S.P., Leiper, F.C., Woods, A., Carling, D., and Carlson, M. 2003. Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases. Proc. Natl. Acad. Sci. 100: 88398843.
Janosik, M., Kery, V., Gaustadnes, M., Maclean, K.N., and Kraus, J.P. 2001. Regulation of human cystathionine ß-synthase by S-adenosyl-L-methionine: Evidence for two catalytically active conformations involving an autoinhibitory domain in the C-terminal region. Biochemistry 40: 1062510633.[CrossRef][Medline]
Kawaguchi, T., Osatomi, K., Yamashita, H., Kabashima, T., and Uyeda, K. 2002. Mechanism for fatty acid "sparing" effect on glucose-induced transcription: Regulation of carbohydrate-responsive element-binding protein by AMP-activated protein kinase. J. Biol. Chem. 277: 38293835.
Kemp, B.E., Stapleton, D., Campbell, D.J., Chen, Z.P., Murthy, S., Walter, M., Gupta, A., Adams, A.J., Katsis, F., van Denderen, B., et al. 2003. AMP-activated protein kinase, super metabolic regulator. Biochem. Soc. Trans. 31: 162168.[Medline]
Kluijtmans, L.A., Boers, G.H., Stevens, E.M., Renier, W.O., Kraus, J.P., Trijbels, F.J., van den Heuvel, L.P., and Blom, H.J. 1996. Defective cystathionine ß-synthase regulation by S-adenosylmethionine in a partially pyridoxine responsive homocystinuria patient. J. Clin. Invest. 98: 285289.[Medline]
Krebs, E.G. 1954. The effect of salmine on the activity of phosphorylase. Biochim. Biophys. Acta 15: 508515.[Medline]
Leclerc, I., Lenzner, C., Gourdon, L., Vaulont, S., Kahn, A., and Viollet, B. 2001. Hepatocyte nuclear factor-4
involved in type 1 maturity-onset diabetes of the young is a novel target of AMP-activated protein kinase. Diabetes 50: 15151521.
Leff, T. 2003. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem. Soc. Trans. 31: 224227.[Medline]
Lo, W.S., Duggan, L., Tolga, N.C., Emre, Belotserkovskya, R., Lane, W.S., Shiekhattar, R., and Berger, S.L. 2001. Snf1A histone kinase that works in concert with the histone acetyltransferase Gcn5 to regulate transcription. Science 293: 11421146.
Milan, D., Jeon, J.T., Looft, C., Amarger, V., Robic, A., Thelander, M., Rogel-Gaillard, C., Paul, S., Iannuccelli, N., Rask, L., et al. 2000. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science 288: 12481251.
Minokoshi, Y., Kim, Y.B., Peroni, O.D., Fryer, L.G., Muller, C., Carling, D., and Kahn, B.B. 2002. Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415: 339343.[CrossRef][Medline]
Mitchelhill, K.I., Stapleton, D., Gao, G., House, C., Michell, B., Katsis, F., Witters, L.A., and Kemp, B.E. 1994. Mammalian AMP-activated protein kinase shares structural and functional homology with the catalytic domain of yeast Snf1 protein kinase. J. Biol. Chem. 269: 23612364.
Morris, G.M., Goodsell, D.S., Halliday, R.S., Huey, R., Hart, W.E., Belew, R.K., and Olson, A.J. 1998. Automated docking using a Lamarckian genetic algorithm and and empirical binding free energy function. J. Comput. Chem. 19: 16391662.[CrossRef]
Moule, S.K. and Denton, R.M. 1998. The activation of p38 MAPK by the ß-adrenergic agonist isoproterenol in rat epididymal fat cells. FEBS Lett. 439: 287290.[CrossRef][Medline]
Nicholls, A., Sharp, K.A., and Honig, B. 1991. Protein folding and association: Insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11: 281296.[CrossRef][Medline]
Park, S.H., Gammon, S.R., Knippers, J.D., Paulsen, S.R., Rubink, D.S., and Winder, W.W. 2002. Phosphorylationactivity relationships of AMPK and acetyl-CoA carboxylase in muscle. J. Appl. Physiol. 92: 24752482.
Peitsch, M.C. 1996. SWISS-MODEL: An automated comparative protein modeling server and a model repository. Fold. Des. 1: S48S49.
Rath, V.L., Ammirati, M., LeMotte, P.K., Fennell, K.F., Mansour, M.N., Danley, D.E., Hynes, T.R., Schulte, G.K., Wasilko, D.J., and Pandit, J. 2000. Activation of human liver glycogen phosphorylase by alteration of the secondary structure and packing of the catalytic core. Mol. Cell 6: 139148.[CrossRef][Medline]
Roussel, A., Fontecilla-Camps, J.C., and Cambillau, C. 1990. CRYStallize: A crystallographic symmetry display and handling subpackage in TOM/FRODO. J. Mol. Graphics 8: 8688, 91.[CrossRef][Medline]
Scott, J.W., Hawley, S.A., Green, K.A., Anis, M., Stewart, G., Scullion, G.A., Norman, D.G. and Hardie, D.G. 2003. CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J. Clin. Invest. (in press).
Sprang, S.R., Withers, S.G., Goldsmith, E.J., Fletterick, R.J., and Madsen, N.B. 1991. Structural basis for the activation of glycogen phosphorylase b by adenosine monophosphate. Science 254: 13671371.
Stoppani, J., Hildebrandt, A.L., Sakamoto, K., Cameron-Smith, D., Goodyear, L.J., and Neufer, P.D. 2002. AMP-activated protein kinase activates transcription of the UCP3 and HKII genes in rat skeletal muscle. Am. J. Physiol. 283: E1239E1248.
Stultz, C.M., White, J.V., and Smith, T.F. 1993. Structural analysis based on state-space modeling. Protein Sci. 2: 305314.[Abstract]
Wilson, W.A., Hawley, S.A., and Hardie, D.G. 1996. Glucose repression/derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr. Biol. 6: 14261434.[CrossRef][Medline]
Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita, S., Noda, M., Kita, S., Ueki, K., et al. 2002. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med. 8: 12881295.[CrossRef][Medline]
Zhang, R., Evans, G., Rotella, F.J., Westbrook, E.M., Beno, D., Huberman, E., Joachimiak, A., and Collart, F.R. 1999. Characteristics and crystal structure of bacterial inosine-5'-monophosphate dehydrogenase. Biochemistry 38: 46914700.[CrossRef][Medline]
Zheng, D., MacLean, P.S., Pohnert, S.C., Knight, J.B., Olson, A.L., Winder, W.W., and Dohm, G.L. 2001. Regulation of muscle GLUT-4 transcription by AMP-activated protein kinase. J. Appl. Physiol. 91: 10731083.
Zhou, M., Lin, B.Z., Coughlin, S., Vallega, G., and Pilch, P.F. 2000. UCP-3 expression in skeletal muscle: Effects of exercise, hypoxia, and AMP-activated protein kinase. Am. J. Physiol. 279: E622E629.
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. Momcilovic, S. H. Iram, Y. Liu, and M. Carlson Roles of the Glycogen-binding Domain and Snf4 in Glucose Inhibition of SNF1 Protein Kinase J. Biol. Chem., July 11, 2008; 283(28): 19521 - 19529. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Iseli, J. S. Oakhill, M. F. Bailey, S. Wee, M. Walter, B. J. van Denderen, L. A. Castelli, F. Katsis, L. A. Witters, D. Stapleton, et al. AMP-activated Protein Kinase Subunit Interactions: {beta}1:{gamma}1 ASSOCIATION REQUIRES {beta}1 Thr-263 AND Tyr-267 J. Biol. Chem., February 22, 2008; 283(8): 4799 - 4807. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Putman, K. J. B. Martins, M. E. Gallo, G. D. Lopaschuk, J. A. Pearcey, I. M. MacLean, R. J. Saranchuk, and D. Pette {alpha}-Catalytic subunits of 5'AMP-activated protein kinase display fiber-specific expression and are upregulated by chronic low-frequency stimulation in rat muscle Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1325 - R1334. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-P. Hong and M. Carlson Regulation of Snf1 Protein Kinase in Response to Environmental Stress J. Biol. Chem., June 8, 2007; 282(23): 16838 - 16845. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Carvajal, E. Zarrinpashneh, O. Szarszoi, F. Joubert, Y. Athea, P. Mateo, B. Gillet, S. Vaulont, B. Viollet, X. Bigard, et al. Dual cardiac contractile effects of the {alpha}2-AMPK deletion in low-flow ischemia and reperfusion Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H3136 - H3147. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Townley and L. Shapiro Crystal Structures of the Adenylate Sensor from Fission Yeast AMP-Activated Protein Kinase Science, March 23, 2007; 315(5819): 1726 - 1729. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Barre, C. Richardson, M. F. Hirshman, J. Brozinick, S. Fiering, B. E. Kemp, L. J. Goodyear, and L. A. Witters Genetic model for the chronic activation of skeletal muscle AMP-activated protein kinase leads to glycogen accumulation Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E802 - E811. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Ellingson, D. G. Chesser, and W. W. Winder Effects of 3-phosphoglycerate and other metabolites on the activation of AMP-activated protein kinase by LKB1-STRAD-MO25 Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E400 - E407. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Birk and J. F. P. Wojtaszewski Predominant {alpha}2/{beta}2/{gamma}3 AMPK activation during exercise in human skeletal muscle J. Physiol., December 15, 2006; 577(3): 1021 - 1032. [Abstract] [Full Text] [PDF] |
||||
|
|