Protein Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published online before print August 31, 2004, 10.1110/ps.04917504
Protein Science (2004), 13:2814-2818. Published by Cold Spring Harbor Laboratory Press. Copyright © 2004 The Protein Society
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ps.04917504v1
13/10/2814    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwartz, T. U.
Right arrow Articles by Blobel, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwartz, T. U.
Right arrow Articles by Blobel, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

FOR THE RECORD

Circular permutation as a tool to reduce surface entropy triggers crystallization of the signal recognition particle receptor {beta} subunit

Thomas U. Schwartz1,2, Rudolf Walczak1 and Günter Blobel1

1 Howard Hughes Medical Institute, Laboratory of Cell Biology, The Rockefeller University, New York, New York 10021, USA
2 Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA

Reprint requests to: Thomas U. Schwartz, Department of Biology, Room 68-480, Massachusetts Institute of Technology, Cambridge, MA 02139, USA; e-mail: tus{at}mit.edu; fax: (617) 253-8699.

(RECEIVED June 8, 2004; FINAL REVISION July 6, 2004; ACCEPTED July 7, 2004)


   Abstract
TOP
 Abstract
Introduction
 Results and Discussion
 Materials and methods
 References
 
The production of diffraction-quality crystals remains a difficult obstacle on the road to high-resolution structural characterization of proteins. This is primarily a result of the empirical nature of the process. Although crystallization is not predictable, factors inhibiting it are well established. First, crystal formation is always entropically unfavorable. Reducing the entropic cost of crystallizing a given protein is thus desirable. It is common practice to map boundaries and remove unstructured regions surrounding the folded protein domain. However, a problem arises when flexible regions are not at the boundaries but within a domain. Such regions cannot be deleted without adding new restraints to the domain. We encountered this problem during an attempt to crystallize the {beta} subunit of the eukaryotic signal recognition particle (SR{beta}), bearing a long and flexible internal loop. Native SR{beta} did not crystallize. However, after circularly permuting the protein by connecting the spatially close N and C termini with a short heptapeptide linker GGGSGGG and removing 26 highly flexible loop residues within the domain, we obtained diffraction-quality crystals. This protein-engineering method is simple and should be applicable to other proteins, especially because N and C termini of protein domains are often close in space. The success of this method profits from prior knowledge of the domain fold, which is becoming increasingly common in today’s postgenomic era.

Keywords: X-ray crystallography; protein engineering; circular permutation; G-proteins

Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.04917504.


   Introduction
TOP
 Abstract
 Introduction
Results and Discussion
 Materials and methods
 References
 
Because an ultimate understanding of a protein’s function is impossible without knowledge of its structure, the structural determination of proteins is at the forefront of biological and medical research. X-ray crystallography remains the most powerful technique for solving the three-dimensional structure of proteins.

A prerequisite for such studies, and often the rate-limiting step in the process, is the production of protein crystals of suitable quality. Technological advances have made it possible to easily screen a wide range of crystallization conditions within a day. However, statistical data from structural genomics centers reveal that increasing the number of crystallization trials does not correlate with the success rate of crystallizing a particular protein (Service 2002). It turns out that a certain fraction (about 10%) of soluble proteins crystallizes relatively easily in many conditions, whereas the remaining 90% are recalcitrant (Claverie et al. 2002; Ding et al. 2002; Sulzenbacher et al. 2002). As a consequence, the protein itself should be regarded as the key variable in crystallization trials (Longenecker et al. 2001; Dale et al. 2003).

Crystallization is still a largely empirical process, and there is no evidence that this situation will change in the near future. However, although one cannot predict which proteins will crystallize, some obvious factors clearly hamper the effort.

One key concept is to keep protein flexibility as low as possible. Flexible regions at the N and C termini of protein domains are routinely removed to reduce surface conformational entropy; this is often a prerequisite to obtaining crystals (Dale et al. 2003). Flexible regions are unlikely to form stable crystal contacts, and removing these regions increases the proportion of surface regions that potentially form such contacts. The concept of surface entropy reduction has recently been extended to individually replacing the most flexible residues on the protein surface with more rigid residues (Garrard et al. 2001; Longenecker et al. 2001; Mateja et al. 2002). This method not only removes sites unlikely to form crystal contacts but also introduces new epitopes that potentially mediate contacts.

Here we report the crystallization of the {beta} subunit of the eukaryotic signal recognition particle receptor (SR) from Saccharomyces cerevisiae. SR{beta} is a key regulator of co-translational protein transport across the ER membrane (Keenan et al. 2001) and is a unique G protein. The structure of SR{beta} was recently determined in complex with the interaction domain SRX of the {alpha} subunit of SR (Schwartz and Blobel 2003). G proteins act as molecular on/off switches (Vetter and Wittinghofer 2001): They are on when bound to GTP and off when bound to GDP or, occasionally, when they have no nucleotide bound. The switch cycle is defined by distinct conformations of the protein that depend on the bound nucleotide.

In complex with SR{alpha}, SR{beta} is GTP bound. The structure of the isolated GDP-bound form is required to fully characterize the switch cycle of SR{beta}. Although we were able to purify and specifically load the isolated SR{beta} domain with GDP, crystallization attempts failed. From the SR{beta}-GTP:SRX structure, a highly flexible loop of about 30 residues was known, and we speculated that this region might be causing the problems with crystallization. We used molecular cloning techniques to remove the entire flexible loop and, in its place, connected the closely proximal N and C termini of the protein domain with heptapeptide linker GGGSGGG. The resulting circularly permuted protein was functional and readily crystallized; we obtained diffraction data to 2.2 Å resolution. Because disordered loop regions are a common feature of protein domains, especially those of eukaryotic origin, the described method offers a new option in crystallization of other difficult proteins exhibiting similar features.


   Results and Discussion
TOP
 Abstract
 Introduction
 Results and Discussion
Materials and methods
 References
 
Design and characterization of the circularly permuted protein
In the crystal structure of SR{beta}-GTP:SRX, a stretch of poorly ordered and poorly conserved residues was observed in SR{beta} in the long loop between helix {alpha}4 and strand {beta}6 (residues Val 189-Asp 210; Schwartz and Blobel 2003). Because crystallizing the uncomplexed GDP-bound SR{beta} subunit failed, we speculated that this flexible region might be causing the problem. G proteins change their conformation depending on the nucleotide bound. Therefore, we could not rule out the possibility that the secondary structural elements connected by the long loop, notably helix {alpha}4, change their spatial orientation as part of the switch cycle. For this reason, mere truncation of the loop might interfere with the switch cycle and was thus not considered a viable option. We rather exploited the proximity of the N and C termini of the G domain of SR{beta}, which made circular permutation of the protein possible (Fig. 1Go). By connecting the N and C termini with a short flexible heptapeptide linker GGGSGGG we were able to create a new N terminus at the beginning of strand {beta}6 and a new C terminus at the protruding helix {alpha}4 at Lys 183. Using this method, we removed the entire flexible loop, including the terminal helical turn of 34. The circularly permuted protein was named SR{beta}D210K183.



View larger version (54K):
[in this window]
[in a new window]
  		Figure 1. Cloning of SR{beta}D210K183. The circularly permuted protein was constructed by removing residues Lys 184 through Thr 209 (red), rendering Asp 210 and Lys 183 the new N and C termini, respectively. The original N and C termini, Ser 36 and Leu 244, were bridged with a flexible heptapeptide linker GGGSGGG (green dotted line). The ribbon diagram represents SR{beta}-GTP from PDB entry 1NRJ [PDB] .

 
Purification and functional characterization of SR{beta}D210K183
SR{beta}D210K183 was purified under native conditions from the soluble fraction of the Escherichia coli expression strain BL21(DE3) grown at 30°C. The expression level for the wild-type and circularly permuted versions of SR{beta} were indistinguishable (Fig. 2Go). Very similar amounts of both SR{beta} versions were purified to homogeneity using the same protocol. SR{beta} is GTP-bound when isolated from E. coli (data not shown). Using size-exclusion chromatography in the presence of EDTA, we were able to prepare nucleotide-free SR{beta}. FPLC-purified GDP was then added, together with MgCl2, to obtain GDP-bound SR{beta}.



View larger version (101K):
[in this window]
[in a new window]
  		Figure 2. SDS-PAGE analysis of the protein purification of wild-type SR{beta} (A) in comparison to SR{beta}D210K183 (B). Lane M, molecular weight marker; lane 1, total protein; lane 2, Ni-affinity purified protein; lane 3, after removal of N-terminal His-tag; lane 4, gel-filtered protein.

 
To ensure that SR{beta}D210K183 is properly folded, we tested the protein’s ability to bind the interaction domain SRX of SR{alpha}, as compared to wild-type SR{beta}. For that purpose, SR{beta}D210K183 and SRX were coexpressed in E. coli and analyzed as described for SR{beta}:SRX (Schwartz and Blobel 2003). SR{beta}D210K183 and SRX form a stable and stoichiometric complex comparable to SR{beta}:SRX (Fig. 3Go). This indicates proper folding of SR{beta}D210K183.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 3. Functional analysis SR{beta}D210K183. Gel filtration on a Superdex75 HR10/30 (GE Healthcare) column shows that SR{beta}D210K183 forms a stable complex with the SRX domain of SR{alpha} (red trace), very similar to wild-type SR{beta} (blue trace). (Inset) SDS-PAGE analysis of the peak fraction, confirming the stoichiometric presence of the complexed proteins. Lane 1, SR{beta}-GTP:SRX; lane 2, SR{beta}D210K183-GTP:SRX; lane M, molecular weight marker.

 
SR{beta}D210K183 bound to GDP was crystallized from micro-batch setups under paraffin oil; we collected a complete diffraction data set to 2.2 Å resolution (Table 1Go).


View this table:
[in this window]
[in a new window]
  		Table 1. Data collection statistics
 
Conclusion
Surface entropy reduction is widely recognized as an approach to enhance the likelihood of crystallizing a specific protein. Based on this concept, mapping domain boundaries is routine. In an extension of the theme, point mutations are now being successfully used to reduce the surface entropy, triggering crystallization as a result (Derewenda 2004). In this study, we introduce a new method to reduce surface entropy by circularly permuting a protein, here SR{beta}, allowing for the removal of flexible internal loops by connecting spatially close N and C termini. In contrast to native SR{beta}, the resulting engineered protein SR{beta}D210K183 readily crystallized. Preliminary structural analysis shows that the modified regions of the protein are not involved in crystal contact (data not shown), suggesting that, indeed, surface entropy reduction was the deciding factor that led to crystal formation. Initially, obtained crystals did not diffract beyond 3.8 Å, but we found an annealing procedure that enabled us to collect a 2.2 Å data set (see Materials and Methods). Annealing methods are generally used to overcome increased crystal mosaicity as a result of flash freezing (Hanson et al. 2003). There is no indication that the necessity for crystal annealing in this study is a result of the protein engineering method applied.

The removal of flexible loops is particularly important for the study of eukaryotic proteins, where flexible protein regions are much more abundant than in prokaryotic proteins. More than 50% of eukaryotic proteins contain stretches of more than 40 disordered residues (Vucetic et al. 2003).

Circular permutation of proteins in nature is not rare (Lindqvist and Schneider 1997; Uliel et al. 2001). Structural studies of circularly permuted proteins have shown that they fold in a similar fashion as their nonpermuted relatives (Hahn et al. 1994; Pieper et al. 1997; Ay et al. 1998; Tougard et al. 2002) and function properly.

Removing long and flexible loops within a protein domain by connecting N and C termini with a short linker is principally possible when the N and C termini of the protein are proximal in space. Interestingly, it has long been observed that many proteins have close N and C termini (Thornton and Sibanda 1983). In a recent study on a representative ensemble of protein structures, almost 30% were found to have N and C termini not farther apart than 25 Å, a distance easily bridged by a short peptide linker (L. Chiche and J. Gracy, pers. comm.). Thus, our method of reducing surface entropy by circular permutation is not confined to isolated cases but should be applicable for many proteins.

The design of functional, circularly permuted proteins profits from prior knowledge of the domain fold. Because this information is available for an increasing number of proteins (Soding and Lupas 2003), circular permutation might be especially useful for crystallizing difficult human proteins whose overall domain structure can be deduced from a homolog. Modeling human proteins, often drug targets, based on homolog structures cannot adequately replace knowledge of the proteins’ actual structures. This is particularly true for surface epitopes, which are crucial to identifying specific drug-binding sites.


   Materials and methods
TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and methods
References
 
Plasmid construction
Fragments of the srp102 gene coding for amino acids Ser 36 to Lys 183 (fragment A) and Asp 210 to Leu 244 (fragment B) of SR{beta}, were PCR-amplified using genomic DNA from Saccharomyces cerevisiae as a template. Fragment A was amplified using the following oligonucleotide primers: forward primer A_f 5'-AAGG ATCCGGTGGCGGTAGTTATCAACCATCTATTATC (BamHI site underlined, additional glycine codons in bold); reverse primer A_r 5'-GCTGCAAGCTTATTTCCTTCTTTCAATAACC (HindIII site underlined, stop codon in bold). Fragment B was amplified with forward primer B_f 5'-GTGGTGTCCATATGGACGGG TTCAAATTTGC (NdeI site underlined) and reverse primer B_r 5'-TTGGATCCGCC GCCCAGTTTTTCATCTATCCATTC (BamHI site underlined, additional glycine codons in bold). Fragments A and B were digested with BamHI and ligated. The desired ligation product 5'-BA-3' was separated by size from the by-products 5'-AA-3' and 5'-BB-3' via agarose gel electrophoresis. The isolated fragment 5'-BA-3' was digested with NdeI and HindIII and cloned into pET28a (Novagen), which was engineered to carry a PreScission site in place of the original thrombin site. The resulting plasmid (pSR{beta}D209K183) allows the production of the circularly permuted N-terminally His-tagged variant, SR{beta}D210K183, in which the natural termini are joined by a heptapeptide linker GGGSGGG and where the chain is broken between Lys 183 and Asp 210, removing 26 flexible surface residues.

Protein purification
SR{beta}D210K183 was expressed in E. coli BL21 (DE3) at 30°C. Cells were grown in LB medium [0.4% (w/v) glucose, 25 µg/mL kanamycin] and induced with 0.2mM isopropyl-{beta}-thiogalactopyranoside for 2.5 h. Harvested cells were resuspended in 10 mM Tris-HCl at pH 8.0, 250 mM NaCl, 5 mM imidazole, 5 mM {beta}-mercaptoethanol ({beta}-ME), 0.2 mM PMSF and lysed with a cell disruptor (Avestin). After centrifugation, the soluble fraction of the lysate was subjected to Ni-affinity chromatography using Ni-NTA agarose (Qiagen) The resin was washed with 10 mM Tris-HCl at pH 8.0, 250 mM NaCl, 5 mM imidazole, 5 mM {beta}-ME in batch, poured in a column and washed with four volumes of 10 mM Tris-HCl at pH 8.0, 250 mM NaCl, 30 mM imidazole, 5 mM {beta}-ME. The protein was eluted with 10mM Tris-HCl at pH 8.0, 250 mM NaCl, 150 mM imidazole, 5 mM {beta}-ME.

The eluate was dialyzed overnight against 10 mM Hepes at pH 7.5, 250 mM NaCl, 1 mM DTT, 0.5 mM EDTA. Four hours into the dialysis, PreScission protease (GE Healthcare) was added in a 1:100 (w/w) ratio to remove the N-terminal His-tag.

Following cleavage and dialysis, SR{beta}D210K183 was applied to size exclusion hromatography (Superdex 75, GE Healthcare), which was carried out in 10 mM Hepes at pH 7.5, 250 mM NaCl, 1 mM DTT, 0.5 mM EDTA. Apart from purifying the protein, this procedure resulted in removing any bound nucleotide.

The purified and nucleotide-free protein was incubated with a 10-fold molar excess of GDP, 10 mM MgCl2, and 5 mM DTT, and subsequently concentrated. At a protein concentration of 2 mg/mL, 1 mM GDP was added, followed by further concentration. At a protein concentration of 20 mg/mL, aliquots were flash-frozen in liquid nitrogen and stored at –80°C.

Crystallization and data collection
Crystals of SR{beta}D210K183 were obtained after 3–7 d at 4°C using the microbatch method under paraffin oil mixing 2 µL of protein at 20 mg/mL and 2 µL of the precipitant (0.1 M Bis-Tris-HCl at pH 5.5, 2.6 M ammonium sulfate). The crystals grew as needles with a size of up to 50 x 50x 500 µm. A somewhat peculiar freezing regiment was necessary to obtain high-resolution diffraction data. The crystals were first directly flash-frozen in liquid nitrogen, subsequently thawed again at 4°C, washed in cryoprotectant (0.1 M Bis-Tris-HCl at pH 5.5, 2.0 M ammonium sulfate, 18% glycerol) for 1 min, and refrozen. The latter thaw–freeze cycle was then repeated at room temperature, leading to crystals diffracting beyond 2.2 Å resolution. The method was highly reproducible. Changing the order or omitting steps of the procedure consistently resulted in poor diffraction not exceeding 3.8 Å resolution. Diffraction data were collected at 100 K from a single frozen crystal on a MarCCD-165 area detector at beamline X9A, National Synchrotron Light Source (Brookhaven, NY).

Binding studies of SR{beta}D210K183 and SRX
SR{beta}D210K183 and the interaction domain SRX of SR{alpha} (residues 1–158) were coexpressed in E. coli BL21 (DE3) from two separate plasmids. The resulting protein complex was purified following the same protocol as described for SR{beta}:SRX (Schwartz and Blobel 2003).


   Acknowledgments
 
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.


   References
TOP
 Abstract
 Introduction
 Results and Discussion
 Materials and methods
 References
 
Ay, J., Hahn, M., Decanniere, K., Piotukh, K., Borriss, R., and Heinemann, U. 1998. Crystal structures and properties of de novo circularly permuted 1,3–1,4-{beta}-glucanases. Proteins 30: 155–167.[CrossRef][Medline]

Claverie, J.M., Monchois, V., Audic, S., Poirot, O., and Abergel, C. 2002. In search of new anti-bacterial target genes: A comparative/structural genomics approach. Comb. Chem. High Throughput Screen. 5: 511–522.[Medline]

Dale, G.E., Oefner, C., and D’Arcy, A. 2003. The protein as a variable in protein crystallization. J. Struct. Biol. 142: 88–97.[CrossRef][Medline]

Derewenda, Z.S. 2004. Rational protein crystallization by mutational surface engineering. Structure 12: 529–535.[Medline]

Ding, H.T., Ren, H., Chen, Q., Fang, G., Li, L.F., Li, R., Wang, Z., Jia, X.Y., Liang, Y.H., Hu, M.H., et al. 2002. Parallel cloning, expression, purification and crystallization of human proteins for structural genomics. Acta Crystallogr. D. 58: 2102–2108.[CrossRef][Medline]

Garrard, S.M., Longenecker, K.L., Lewis, M.E., Sheffield, P.J., and Derewenda, Z.S. 2001. Expression, purification, and crystallization of the RGS-like domain from the Rho nucleotide exchange factor, PDZ-RhoGEF, using the surface entropy reduction approach. Protein Expr. Purif. 21: 412–416.[CrossRef][Medline]

Hahn, M., Piotukh, K., Borriss, R., and Heinemann, U. 1994. Native-like in vivo folding of a circularly permuted jellyroll protein shown by crystal structure analysis. Proc. Natl. Acad. Sci. 91: 10417–10421.[Abstract/Free Full Text]

Hanson, B.L., Harp, J.M., and Bunick, G.J. 2003. The well-tempered protein crystal: Annealing macromolecular crystals. Methods Enzymol. 368: 217–235.[CrossRef][Medline]

Keenan, R.J., Freymann, D.M., Stroud, R.M., and Walter, P. 2001. The signal recognition particle. Annu. Rev. Biochem. 70: 755–775.[CrossRef][Medline]

Lindqvist, Y., and Schneider, G. 1997. Circular permutations of natural protein sequences: Structural evidence. Curr. Opin. Struct. Biol. 7: 422–427.[CrossRef][Medline]

Longenecker, K.L., Garrard, S.M., Sheffield, P.J., and Derewenda, Z.S. 2001. Protein crystallization by rational mutagenesis of surface residues: Lys to Ala mutations promote crystallization of RhoGDI. Acta Crystallogr. D. 57: 679–688.[CrossRef][Medline]

Mateja, A., Devedjiev, Y., Krowarsch, D., Longenecker, K., Dauter, Z., Otlewski, J., and Derewenda, Z.S. 2002. The impact of Glu->Ala and Glu->Asp mutations on the crystallization properties of RhoGDI: The structure of RhoGDI at 1.3 Å resolution. Acta Crystallogr. D. 58: 1983–1991.[CrossRef][Medline]

Pieper, U., Hayakawa, K., Li, Z., and Herzberg, O. 1997. Circularly permuted {beta}-lactamase from Staphylococcus aureus PC1. Biochemistry 36: 8767–8774.[CrossRef][Medline]

Schwartz, T., and Blobel, G. 2003. Structural basis for the function of the {beta} subunit of the eukaryotic signal recognition particle receptor. Cell 112: 793–803.[CrossRef][Medline]

Service, R.F. 2002. Structural genomics. Tapping DNA for structures produces a trickle. Science 298: 948–950.[Abstract/Free Full Text]

Soding, J., and Lupas, A.N. 2003. More than the sum of their parts: On the evolution of proteins from peptides. Bioessays 25: 837–846.[CrossRef][Medline]

Sulzenbacher, G., Gruez, A., Roig-Zamboni, V., Spinelli, S., Valencia, C., Pagot, F., Vincentelli, R., Bignon, C., Salomoni, A., Grisel, S., et al. 2002. A medium-throughput crystallization approach. Acta Crystallogr. D. 58: 2109–2115.[CrossRef][Medline]

Thornton, J.M., and Sibanda, B.L. 1983. Amino and carboxy-terminal regions in globular proteins. J. Mol. Biol. 167: 443–460.[CrossRef][Medline]

Tougard, P., Bizebard, T., Ritco-Vonsovici, M., Minard, P., and Desmadril, M. 2002. Structure of a circularly permuted phosphoglycerate kinase. Acta Crystallogr. D 58: 2018–2023.[CrossRef][Medline]

Uliel, S., Fliess, A., and Unger, R. 2001. Naturally occurring circular permutations in proteins. Protein Eng. 14: 533–542.[Abstract/Free Full Text]

Vetter, I.R., and Wittinghofer, A. 2001. The guanine nucleotide-binding switch in three dimensions. Science 294: 1299–1304.[Abstract/Free Full Text]

Vucetic, S., Brown, C.J., Dunker, A.K., and Obradovic, Z. 2003. Flavors of protein disorder. Proteins 52: 573–584.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
W.-C. Lo, C.-C. Lee, C.-Y. Lee, and P.-C. Lyu
CPDB: a database of circular permutation in proteins
Nucleic Acids Res., October 8, 2008; (2008) gkn679v1.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. U. Schwartz, D. Schmidt, S. G. Brohawn, and G. Blobel
Homodimerization of the G protein SRbeta in the nucleotide-free state involves proline cis/trans isomerization in the switch II region
PNAS, May 2, 2006; 103(18): 6823 - 6828.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ps.04917504v1
13/10/2814    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwartz, T. U.
Right arrow Articles by Blobel, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwartz, T. U.
Right arrow Articles by Blobel, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS