Protein Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online before print May 28, 2004, 10.1110/ps.04716104
Protein Science (2004), 13:1902-1907. Published by Cold Spring Harbor Laboratory Press. Copyright © 2004 The Protein Society
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ps.04716104v1
13/7/1902    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solovyov, A.
Right arrow Articles by Gilbert, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solovyov, A.
Right arrow Articles by Gilbert, H. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Zinc-dependent dimerization of the folding catalyst, protein disulfide isomerase

Anton Solovyov and Hiram F. Gilbert

Verna and Marrs McLean Department of Biochemistry, Baylor College of Medicine, Houston, Texas 77030, USA

Reprint requests to: Hiram F. Gilbert, Verna and Marrs McLean Department of Biochemistry, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030, USA; e-mail: hgilbert{at}bcm.tmc.edu; fax: (713) 796-9438.

(RECEIVED March 1, 2004; FINAL REVISION March 24, 2004; ACCEPTED March 24, 2004)


    Abstract
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Protein disulfide isomerase (PDI), an essential folding catalyst and chaperone of the endoplasmic reticulum (ER), has four structural domains (a-b-b'-a'-) of approximately equal size. Each domain has sequence or structural homology with thioredoxin. Sedimentation equilibrium and velocity experiments show that PDI is an elongated monomer (axial ratio 5.7), suggesting that the four thioredoxin domains are extended. In the presence of physiological levels (<1 mM) of Zn2+ and other thiophilic divalent cations such as Cd2+ and Hg2+, PDI forms a stable dimer that aggregates into much larger oligomeric forms with time. The dimer is also elongated (axial ratio 7.1). Oligomerization involves the interaction of Zn2+ with the cysteines of PDI. PDI has active sites in the N-terminal (a) and C-terminal (a')thioredoxin domains, each with two cysteines (CGHC). Two other cysteines are found in one of the internal domains (b'). Cysteine to serine mutations show that Zn2+-dependent dimerization occurs predominantly by bridging an active site cysteine from either one of the active sites with one of the cysteines in the internal domain (b'). The dimer incorporates two atoms of Zn2+ and exhibits 50% of the isomerase activity of PDI. At longer times and higher PDI concentrations, the dimer forms oligomers and aggregates of high molecular weight (>600 kDa). Because of a very high concentration of PDI in the ER, its interaction with divalent ions could play a role in regulating the effective concentration of these metal ions, protecting against metal toxicity, or affecting the activity of other (ER) proteins that use Zn2+ as a cofactor.

Keywords: zinc; protein disulfide isomerase; disulfide; oligomerization; protein folding

Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.04716104.


    Introduction
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Protein disulfide isomerase (PDI) is a ubiquitous, essential enzyme found in the endoplasmic reticulum (ER) of all eukaryotes. PDI catalyzes a set of disulfide-exchange reaction that includes oxidation of sulfhydryl groups into disulfides, reduction of disulfides, and rearrangement of disulfide bonds to correct folding mistakes. PDI also has chaperone activity and is found as a subunit of several multi-subunit enzymes. The catalytic site of PDI consists of a dithiol/disulfide center that undergoes redox state changes during catalysis (Gilbert 1997).

PDI has four structural domains (a-b-b'-a'), each with sequence and/or structural homology to the small redox protein, thioredoxin. The two catalytic domains (a and a') each have active site sequences CGHC, and two additional cysteines are located in the internal, b' domain (Edman et al. 1985). The "internal" cysteines do not contribute to PDI activity; replacement of all four active site cysteines with serines completely eliminates the disulfide-exchange activity of PDI (Lyles and Gilbert 1994), and replacing the b' cysteines with serines does not affect catalytic activity.

PDI, even when highly purified, may form a set of heterogeneous molecular species under various conditions (Pace and Dixon 1979). PDI purified from bovine liver microsomes contains dimers, and possibly higher molecular weight species, that are linked by disulfide bonds (Carmichael et al. 1979; Pace and Dixon 1979). It has also been noted that PDI that is homogeneous on SDS-PAGE can be separated into two species on gel-filtration or ion-exchange HPLC (Hu and Tsou 1992). The smaller species was found to be more catalytically active. At first, the heterogeneity was attributed to C-terminal proteolysis, but later, the same investigators found that the two components of PDI preparations had the same amino acid composition. Gel filtration indicated that they were tetramers and dimers with apparent molecular masses of 240 kDa and 120 kDa, respectively (Yu et al. 1994).

In our laboratory, PDI is normally purified by a two-step technique that involves chromatography on Zn2+-chelating Sepharose (Gilbert et al. 1991). It was noticed that under certain conditions, Zn2+ and other thiophilic divalent cations (Cd2+, Hg2+) cause the association of PDI into higher-molecular-weight species. In addition, Baksh et al. (1995) reported that PDI interacts with calreticulin, another ER-resident protein, in a Zn-dependent manner. The Zn2+-dependent association with calreticulin and the long-standing observations of various oligomeric forms of PDI, prompted an investigation of the interactions of Zn2+ with PDI. In this article, we find that Zn2+ at physiological concentrations (~1 mM; Alfaro and Heaton 1974) inhibits the isomerase activity of PDI by half and induces the formation of PDI dimers and higher-order aggregates by non-covalently cross-linking an active site cysteine with a cysteine in the b' domain. We have also found that PDI and its dimer are very elongated and show anomalous molecular weights by gel filtration.


    Results
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Treatment of reduced rat PDI (sequence molecular mass of 55 kDa) with mM concentrations of Zn2+ at pH 7.0 (50 mM HEPES) results in the formation of higher-molecular-weight species (Fig. 1Go). Although the sequence molecular mass is 55 kDa, gel-filtration HPLC calibrated against protein molecular mass standards shows that PDI that has not been treated with Zn2+ displays an apparent molecular mass of 108 ± 9 kDa. After incubation with Zn2+, species with molecular masses of 236 ± 30 kDa and >600 kDa appear. With increasing Zn2+ concentration, an increasing amount of the 108 kDa disappears and is converted to higher-molecular-weight species (Fig. 2Go). The time course of the oligomerization (Fig. 3Go) shows that with time, the low-molecular-weight species are converted increasingly to large aggregates (>600 kDa). Other thiophilic divalent cations (Hg2+ and Cd2+) show the same behavior at concentrations of 0.5 mM (data not shown). However, divalent cations such as Ca2+ and Mg2+ are without effect at concentrations of up to 5 mM. In addition, the presence of 5 mM Ca2+ or Mg2+ does not prevent the Zn2+-dependent oligomerization.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Oligomerization of PDI in the presence of Zn2+. PDI (4.4 µM) was incubated with 1 mM zinc acetate at room temperature for the indicated time and then separated by gel-filtration HPLC. Initially (0 h, top left), PDI was all monomeric. After 1 h, three peaks could be observed (top right), corresponding to aggregate (A), dimer (D), and monomer (M). After 3 or 24 h of incubation (bottom), more PDI is converted into dimer and eventually aggregates.

 


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Dependence of the disappearance of PDI monomer on the concentration of Zn2+. PDI (20 µM) was incubated in 50 mM HEPES (pH 7.0) with different concentrations of Zn2+ for 17 h at room temperature, and the amount of residual monomer determined by gel-filtration HPLC is shown. The curve is a rectangular hyperbola with a Zn1/2 of 0.2 ± 0.03 mM.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Time dependence of PDI oligomerization. PDI (4.4 µM) was incubated with 1 mM Zn2+ for various times, and the amounts of 100-kDa species, 200-kDa species, and aggregates (>600 kDa) were determined by gel-filtration HPLC: monomer (solid circles), dimer (solid squares), and aggregate (open circles).

 
After incubation with Zn2+ (1 mM for 2 h), the species with apparent molecular masses of 108 and 236 kDa were isolated by gel-filtration HPLC. Determination of the bound Zn2+, using the absorbance changes due to the chelation of Zn2+ by 4-(2-pyridylazo)resorcinol (PAR; McCall and Fierke 2000), showed that the 236-kDa species contained an equimolar ratio of Zn2+ to the 55-kDa PDI monomer (Zn2+/ PDI = 1.0 ± 0.1). This Zn-coordinated oligomer of PDI was also an active catalyst of disulfide isomerization, but it displayed only 43 ± 6% of the isomerase activity of PDI that had not been incubated with Zn2+. The species with an apparent molecular mass of 108 kDa, by gel-filtration HPLC, had 0.69 ± 0.04 moles of Zn2+ per PDI, suggesting that both are capable of binding Zn2+.

Although the gel-filtration results suggest that PDI (55 kDa by sequence) is a dimer that zinc converts to a tetramer, sedimentation equilibrium measurements show that the 108-kDa species is actually a monomer (Table 1Go) and the 236-kDa species is actually a PDI-dimer. Because gel-filtration is sensitive to the shape of the molecule, sedimentation velocity experiments were performed to evaluate the hydrodynamic properties. The sedimentation coefficients of the monomer suggest that PDI is quite elongated with an axial ratio (a/b) of 5.7. The dimer is also elongated (a/b = 7.1; Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Analytical ultracentrifugation of PDI and its oligomer
 
The finding that the divalent cations that support PDI oligomerization are all "soft" cations with affinity for sulfur suggests that the oligomerization is dependent on PDI sulfhydryl groups. In confirmation of this suspicion, mutation of all six PDI cysteines to serines eliminates the formation of dimer and higher oligomers (Fig. 4Go). Replacement of the two cysteines in the b' domain with serines also largely eliminates dimer formation, and replacing all four of the active site cysteines with serine shows that one or both of the PDI active sites are needed (along with those in the b' domain) to generate dimers and higher oligomers. Eliminating the active site cysteines of one of the catalytic domains affects the amount of dimer formed slightly but does not prevent dimerization. Thus, either of the active sites can participate in dimer formation.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Oligomerization of PDI mutants with cysteine to serine mutations. The amount of the PDI present as dimer after 1-h incubation with 1 mM Zn2+ was determined by HPLC. The reaction is not kinetically complete at this time point, and the amount of dimer formed is a complex function between aggregation and dimerization. The mutants are designated by a symbol showing the three different types of cysteine residues, including those of the CGHC sequence at the two active sites and the two located in the b' domain (dotted lines). An empty box indicates that both cysteines have been mutated to serine, and CX indicates that the active site cysteine nearer the C terminus (CGHC) of each active site has been mutated to ser (CGHS).

 
Zn2+ is tetracoordinate, making it possible that the Zn2+ in the dimer is coordinated by four sulfur ligands. However, this is not the case. Mutants in which there is only one cysteine at each active site show that a single active site cysteine is sufficient to mediate oligomerization. The ligand structure of Zn2+ must be more complex than is its coordination of four cysteines.

In addition, to the formation of dimers, high concentrations of PDI and/or long incubation times convert wild-type PDI into large aggregates (>600 kDa; Fig. 1Go). The amount of PDI aggregation increases with increasing PDI concentration (Fig. 5Go). The presence of EDTA in excess over the Zn2+ concentration totally inhibits dimerization and aggregation; however, after formation of the oligomers (24 h with 0.5 mM Zn2+), the addition of EDTA (5 mM) does not reverse oligomer formation substantially, even after a 3-h incubation (data not shown), suggesting that once the dimer is formed, the Zn2+ is not accessible to chelating agents. A mutant PDI that has all its active site cysteines but is missing both of the cysteines in the b' domain (outside the active site) also forms aggregates without forming the PDI-dimer. Thus, the formation of aggregates does not appear to be dependent on the formation of dimers.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. PDI aggregation in the presence of Zn2+. PDI at different concentrations was incubated with 1 mM Zn2+ at pH 7.0 (50 mM HEPES and 0.2 M NaCl) for 1 h. The relative amount of monomer (solid circles), dimer (solid squares), and aggregate (open circles) was determined by gel-filtration HPLC.

 

    Discussion
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The heterogeneity of PDI preparations has been described in the literature on numerous occasions. Pace and Dixon (1979) first reported PDI oligomers that accumulated with storage. At least some of the oligomerization involved the formation of interchain disulfides. The presence of PDI species that exhibit heterogeneity on gel-filtration chromatography, yet show homogeneity by other criteria, has been attributed to C-terminal proteolysis (Hu and Tsou 1992) and formation of dimers (Morjana et al. 1993) or tetramers (Yu et al. 1994).

Although intermolecular disulfide formation may lead to oligomer formation in PDI, the protein can also be cross-linked through cysteines by coordination to Zn2+ and other divalent cations with high affinity for sulfur. Zn2+ at milli-molar concentrations converts wild-type PDI into a dimer, which over time forms higher order oligomers and aggregates. Dimer formation and oligomerization involve cysteines. The cysteines have to be in a reduced sulfhydryl form to support oligomer formation (data not shown), and a mutant PDI with no cysteines does not form dimers or oligomers.

In addition to the four cysteines in the catalytic domains (a and a' ), wild-type PDI contains two cysteines in the noncatalytic b' domain. These cysteines do not contribute to PDI catalysis (Lyles and Gilbert 1994), but they are involved in dimer formation, because mutants in which these cysteines have been changed to serines do not form dimers. One active site is required for dimer formation, although it may be either one of the active sites. Eliminating all the cysteines in both active sites abolishes dimer formation. However, removing the cysteines from only one of the active sites permits dimers to form (Fig. 4Go). The results with mutant PDI molecules suggest that dimers can form in a variety of ways (Fig. 6Go), with Zn2+ chelated between an active site of one PDI molecule and the internal cysteines of another.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. Models for PDI dimerization. Dimer formation can occur through Zn2+-dependent cross-linking of domains a-b' or domains a' -b' . For each type of dimer, the two PDI molecules could be oriented either in parallel or antiparallel directions. This gives rise to the possibility of four different dimers. The monomers are drawn with an axial ratio of 5.7, as suggested by sedimentation velocity experiments.

 
PDI dimers formed by wild-type PDI contain one atom of zinc per molecule of PDI (55 kDa) or two zinc ions per dimer. Two of the dimer models (Fig. 6Go, models 2 and 4) bring two pairs of interaction centers into proximity, which suggests the possibility of multiple Zn2+-dependent cross links per dimer. However, we cannot exclude the possibility that there is another Zn2+ binding site that is independent of the sites involved in cross-linking. The observation of Zn2+ binding by monomeric PDI supports this view.

PDI is often described as a dimer because of its abnormal behavior on gel-filtration chromatography (Hawkins et al. 1991). Sedimentation equilibrium and velocity measurements show that PDI is a monomer in solution and that the anomalous molecular weight by gel-filtration HPLC is due to the elongated shape of the molecule. An axial ratio of 5.7 for monomeric PDI (assuming a prolate ellipsoid model) suggests that the four thioredoxin domains are arranged in a linear fashion. The thioredoxin domains a and b are approximately the same size (Kemmink et al. 1996, 1999) and reasonably globular. Sequence similarity and homology modeling of the structures of the a' and b' domains suggests that they are also thioredoxin folds. Thus, PDI consists of four structural domains, all of which are likely to have thioredoxin folds. A linear arrangement of four globular domains would give an axial ratio of 4. The C-terminal tail along with the interdomain linkers could provide enough extra length to bring the axial ratio to 5.7; however, it would mean that there are few interactions between the domains of PDI. Likewise, the dimeric species is elongated, with an axial ratio of 7.1. This ratio is less than twice that of the monomer (monomer a/b = 5.7), suggesting that dimer formation involves some overlap of the domains, which is consistent with the models in Figure 5Go. The elongated shape of the dimer excludes a side-to-side alignment of the two PDI molecules and suggests that the dimer is also elongated (Fig. 5Go, models 1 and 4).

At high concentrations of PDI and longer incubation times, PDI forms high-molecular-weight aggregates (>600 kDa) in addition to dimers. The observation that mutation of the two cysteines in the b' domain eliminates dimer formation, but does not prevent the formation of aggregates, suggests that the two active sites are involved in aggregate formation and that the dimer is not an obligatory intermediate.

In proteins that incorporate zinc as a structural or catalytic cofactor, Zn2+ is normally coordinated by four ligands. However, four sulfur ligands are not required to bind Zn2+ within the PDI dimer. Mutants of PDI with only one cysteine in the active site dithiol center (CGHS) form dimers almost as efficiently as does wild-type PDI. Because only one active site cysteine is required for dimerization in these mutants, it is unlikely that the wild-type PDI dimer involves both of the cysteines in an active site. Other nearby residues, perhaps histidines, might complete the Zn2+ coordination.

The physiological role of the Zn2+-dependent oligomerization of PDI is not yet clear. Zinc is a micronutrient widely incorporated as a structural or catalytic element in eukaryotic and prokaryotic proteins. It is predicted that the human genome encodes ~200 different versions of zinc-binding motifs, most of which contain cysteines in their zinc-binding centers (Maret 2003; Tapiero and Tew 2003). The average total Zn2+ concentration in whole rat liver (averaged over the whole cell volume) is in the range of 0.5 mM, 18 ± 1% of which is located in the microsomal fraction (Alfaro and Heaton 1974). Because the ER constitutes significantly <20% of the volume of the cell, Zn2+ would be expected to be at a relatively high total concentration in the ER. Metallothionein has been detected in the ER (Bataineh et al. 1986), suggesting that the free concentrations of Zn2+ might be low; however, the total concentration of metallothionein in the ER is not known, particularly in comparison to the total concentration of Zn2+. In Schizosaccharomyces pombe, there is a Zn2+- specific transporter (Zhf) that helps sequester surplus Zn2+ in the ER, suggesting that ER proteins are active participants in cellular Zn2+ metabolism (Borrelly et al. 2002).

In addition to Zn2+, PDI also binds other divalent transition metal ions, many of which are considered toxic, such as Cd2+ and Hg2+. PDI, being a very abundant ER protein, might serve as a temporary metal ion buffer, reversibly sequestering metal ions and preventing them from binding to other proteins. However, the activity of PDI is also essential to the cell, so that the interaction of PDI with these metals might also play a role in their toxicity. In addition to its direct effects on PDI isomerase activity, Zn2+, or other heavy metals in the ER, might also provide regulatory mechanisms to coordinate chaperones and folding catalysts of the ER. Baksh et al. (1995) found that in the presence of Zn2+, PDI could be isolated in a complex with another ER chaperone, calreticulin.


    Materials and methods
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Materials
Chemicals, including 4-(2-pyridylazo) resorcinol (PAR), ZnCl2, HEPES, guanidine hydrochloride, and dithiothreitol (DTT) were purchased from Sigma. Zn2+ acetate was obtained from Banco. P-6 Bio-gel and Chelex resins were from Bio-Rad. LB, agar, other cell culture media, and PCR reagents were from Invitrogen. PCR site-directed mutagenesis kit, DNA modification enzymes, and Escherichia coli strains were from Stratagene. PCR was performed by using Stratagene RoboCycler Gradient temperature cycler. Plasmid sequence verification was done on an ABI automatic sequencer. HPLC was performed by using Beckman System Gold HPLC system with a Bio-Rad DEAE-5-W column for ion-exchange chromatography and Tosohaas 3000SWXL columns for gel-filtration chromatography.

PDI mutagenesis and purification
Mutagenesis to replace the "internal" cysteines of PDI, Cys294 and Cys325, with serines was accomplished by using the PCR-based Stratagene QuikChange site-directed mutagenesis kit. The plasmid pET8c containing the appropriate mutant of PDI was used as a PCR template for mutagenesis. Primers CTGAAGAAGGAG GAATCTCCAGCTGTGCGGC and GCCGCACAGCTGGAGA TTCCTCCTTCTTCAG were designed to replace the N-terminal internal cysteine. The resulting plasmid was purified and used as a template to replace the second, C-terminal, internal cysteine, using GAAGATCACACAATTTTCCCACCACTTCCTGGAG and CTCCAGGAAGTGGTGGGAAAATTGTGTGATCTTC primers. The final plasmid was sequenced to verify the integrity of PDI and used for PDI expression. All PDI variants used in this article were soluble when expressed in E. coli.

Wild-type PDI and mutant proteins were expressed and purified essentially as described in Gilbert et al. (1991). Briefly, PDI-containing plasmids were transformed into the BL21DE3 strain of E. coli. At OD600 nm = 1, cultures were induced with IPTG (0.4 mM). After 10 to 16 h, cells were isolated and disrupted by sonication. After centrifugation, the supernatant was subject to two-stage chromatography, first on DEAE Sephacel and then on Zn-chelating Sepharose. Purified PDI was reduced, treated with EDTA, and dialyzed against 100 mM Tris-HCl buffer. The PDI was further purified by using a Bio-Rad DEAE-5-W ion-exchange column. PDI was eluted with a 0- to 0.5-M NaCl gradient over 30 min. PDI was subjected to an additional step of purification by using gel-filtration HPLC with a Tosohaas 3000SWXL column (two 30 cm columns). PDI was eluted with 200 mM NaCl and 50 mM HEPES (pH 7.0) buffer.

Zn oligomer formation and HPLC experiments
HPLC-purified PDI was reduced overnight in 10 mM DTT at 4°C and centrifugally gel-filtered over a 10x volume of P-6 Bio-gel equilibrated in HPLC gel-filtration buffer (50 mM HEPES and 200 mM NaCl at pH 7.0). PDI concentration was determined by measuring OD280 nm, and the protein was diluted to the appropriate concentration with HPLC buffer, if necessary. PDI was incubated with the indicated Zn2+ concentration in 50 mM HEPES (pH 7.0; 0.2 M NaCl) at room temperature. After the indicated time, samples were subjected to gel-filtration HPLC. Samples of 20 µL were injected and eluted over 30 min (1 mL/min). Incubations of PDI–Zn samples over 24 h were performed at 4°C to prevent protein degradation.

Zn2+ quantitation
The concentrations of PDI and Zn were determined in fractions collected from gel-filtration HPLC. PDI was incubated with 1 mM Zn2+ for 2 h and subjected to HPLC. In each fraction (1 mL), the PDI concentration was determined by A280. Guanidine hydrochloride (8 M), which had been pretreated with Chelex, was added to a final concentration of 4 M, and the samples were incubated for 2 h to denature PDI. Zn2+ was determined by using the absorbance increase at 493 nm due to complex formation with PAR (McCall and Fierke 2000). The Zn2+ concentrations were determined by comparison to standards of known Zn2+ concentrations analyzed under the same conditions.

PDI activity assays
The isomerase activity of PDI was assayed by using reduced ribonuclease as substrate (Lyles and Gilbert 1991). Refolding was initiated by adding reduced ribonuclease (8 µM final concentration) to PDI in a glutathione redox buffer (1 mM GSH and 0.2 mM GSSG). The appearance of native ribonuclease was monitored by following the hydrolysis of the RNase substrate, cGMP, at 296 nm.

Analytical ultracentrifugation
Analytical ultracentrifugation was performed on HPLC-purified PDI monomer and Zn2+-induced oligomers using a Beckman XLA100 analytical ultracentrifuge. The buffer was 50 mM HEPES (pH 7.0) with 0.2 M NaCl. The protein concentration was 1.2 mg/mL. Sedimentation equilibrium was performed at 20,000 rpm for 22 h and 38 h at 20°C to ensure equilibrium. Sedimentation velocity was performed at 50,000 rpm in the same buffer with three two-fold dilutions of protein. Sedimentation coefficients (extrapolated to zero concentration) and the molecular weight were determined by using SEGAL from http://www.biozentrum.unibas.ch/personal/jseelig/AUC/index.html. The frictional coefficients (f/ fo) and axial ratios (a/b) were calculated by using the vbar method in Sednterp obtained from http://www.jphilo.mailway.com.


    Acknowledgments
 
We thank Dr. J. Ching Lee of the University of Texas Medical Branch, Galveston, Texas, for his assistance with the analytical ultracentrifugation experiments. This work was supported by grant GM-40379 from the NIH.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.


    References
 TOP
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Alfaro, B. and Heaton, F.W. 1974. The subcellular distribution of copper, zinc and iron in liver and kidney: Changes during copper deficiency in the rat. Br. J. Nutr. 32: 435–445.[CrossRef][Medline]

Baksh, S., Burns, K., Andrin, C., and Michalak, M. 1995. Interaction of calreticulin with protein disulfide isomerase. J. Biol. Chem. 270: 31338–31344.[Abstract/Free Full Text]

Bataineh, Z.M., Heidger, P.M., Thompson, S.A., and Timms, B.G. 1986. Immunocytochemical localization of metallothionein in the rat prostate gland. Prostate 9: 397–410.[Medline]

Borrelly, G.P., Harrison, M.D., Robinson, A.K., Cox, S.G., Robinson, N.J., and Whitehall, S.K. 2002. Surplus zinc is handled by Zym1 metallothionein and Zhf endoplasmic reticulum transporter in Schizosaccharomyces pombe. J. Biol. Chem. 277: 30394–30400.[Abstract/Free Full Text]

Carmichael, D.F., Keefe, M., Pace, M., and Dixon, J.E. 1979. Interchangeable forms of thiol:protein disulfide oxidoreductase. J. Biol. Chem. 234: 8386–8390.

Edman, J.C., Ellis, L., Blacher, R.W., Roth, R.A., and Rutter, W.J. 1985. Sequence of protein disulphide isomerase and implications of its relationship to thioredoxin. Nature 317: 267–270.[CrossRef][Medline]

Gilbert, H.F. 1997. Protein disulfide isomerase and assisted protein folding. J. Biol. Chem. 272: 29399–29402.[Free Full Text]

Gilbert, H.F., Kruzel, M.L., Lyles, M.M., and Harper, J.W. 1991. Expression and purification of recombinant protein disulfide isomerase in E. coli. Protein Expr. Purif. 2: 194–198.[CrossRef][Medline]

Hawkins, H.C., de Nardi, M., and Freedman, R.B. 1991. Redox properties and cross-linking of the dithiol/disulphide active sites of mammalian protein disulphide-isomerase. Biochem. J. 275: 341–348.

Hu, C.H. and Tsou, C.L. 1992. C-terminal truncation of bovine protein disulfide isomerase increases its activity. Biochem. Biophys. Res. Commun. 183: 714–718.[CrossRef][Medline]

Kemmink, J., Darby, N.J., Dijkstra, K., Nilges, M., and Creighton, T.E. 1996. Structure determination of the N-terminal thioredoxin-like domain of protein disulfide isomerase using multidimensional heteronuclear 13C/15N NMR spectroscopy. Biochemistry 35: 7684–7691.[CrossRef][Medline]

Kemmink, J., Dijkstra, K., Mariani, M., Scheek, R.M., Penka, E., Nilges, M., and Darby, N.J. 1999. The structure in solution of the b domain of protein disulfide isomerase. J. Biomol. NMR 13: 357–368.[CrossRef][Medline]

Lyles, M.M. and Gilbert, H.F. 1991. Catalysis of the oxidative folding of ribonuclease A by protein disulfide isomerase: Dependence of the rate on the composition of the redox buffer. Biochemistry 30: 613–619.[CrossRef][Medline]

———. 1994. Mutations in the thioredoxin sites of protein disulfide isomerase reveal functional non-equivalence of the N- and C-terminal domains. J. Biol. Chem. 269: 30946–30952.[Abstract/Free Full Text]

Maret, W. 2003. Cellular zinc and redox states converge in the metallothionein/ thionein pair. J. Nutr. 133: 1460S–1462S.[Abstract/Free Full Text]

McCall, K.A. and Fierke, C.A. 2000. Colorimetric and fluorimetric assays to quantitate micromolar concentrations of transition metals. Anal. Biochem. 284: 307–315.[CrossRef][Medline]

Morjana, N.A., McKeone, B.J., and Gilbert, H.F. 1993. Guanidine hydrochloride stabilization of a partially unfolded intermediate during the reversible denaturation of protein disulfide isomerase. Proc. Natl. Acad. Sci. 90: 2107–2111.[Abstract/Free Full Text]

Pace, M. and Dixon, J.E. 1979. The nature of the multiple forms of bovine thiol:protein disulfide oxidoreductase. Intl. J. Peptide Protein Res. 14: 409–413.

Tapiero, H. and Tew, K.D. 2003. Trace elements in human physiology and pathology: Zinc and metallothioneins. Biomed. Pharmacother. 57: 399–411.[CrossRef][Medline]

Yu, X., Wang, C., and Tsou, C. 1994. Association and dissociation of protein disulfide isomerase. Biochim. Biophys. Acta 1207: 109–113.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Tian, F.-X. Kober, U. Lewandrowski, A. Sickmann, W. J. Lennarz, and H. Schindelin
The Catalytic Activity of Protein-disulfide Isomerase Requires a Conformationally Flexible Molecule
J. Biol. Chem., November 28, 2008; 283(48): 33630 - 33640.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. K. Rainey-Barger, S. Mkrtchian, and B. Tsai
Dimerization of ERp29, a PDI-like Protein, Is Essential for Its Diverse Functions
Mol. Biol. Cell, April 1, 2007; 18(4): 1253 - 1260.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Y. Goldgur, S. Rom, R. Ghirlando, D. Shkolnik, N. Shadrin, Z. Konrad, and D. Bar-Zvi
Desiccation and Zinc Binding Induce Transition of Tomato Abscisic Acid Stress Ripening 1, a Water Stress- and Salt Stress-Regulated Plant-Specific Protein, from Unfolded to Folded State
Plant Physiology, February 1, 2007; 143(2): 617 - 628.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-j. Li, X.-g. Hong, Y.-y. Shi, H. Li, and C.-c. Wang
Annular Arrangement and Collaborative Actions of Four Domains of Protein-disulfide Isomerase: A SMALL ANGLE X-RAY SCATTERING STUDY IN SOLUTION
J. Biol. Chem., March 10, 2006; 281(10): 6581 - 6588.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Wilkinson, R. Xiao, and H. F. Gilbert
A Structural Disulfide of Yeast Protein-disulfide Isomerase Destabilizes the Active Site Disulfide of the N-terminal Thioredoxin Domain
J. Biol. Chem., March 25, 2005; 280(12): 11483 - 11487.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Sliskovic, A. Raturi, and B. Mutus
Characterization of the S-Denitrosation Activity of Protein Disulfide Isomerase
J. Biol. Chem., March 11, 2005; 280(10): 8733 - 8741.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. van Lith, N. Hartigan, J. Hatch, and A. M. Benham
PDILT, a Divergent Testis-specific Protein Disulfide Isomerase with a Non-classical SXXC Motif That Engages in Disulfide-dependent Interactions in the Endoplasmic Reticulum
J. Biol. Chem., January 14, 2005; 280(2): 1376 - 1383.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ps.04716104v1
13/7/1902    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solovyov, A.
Right arrow Articles by Gilbert, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solovyov, A.
Right arrow Articles by Gilbert, H. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS