|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Chemical Engineering, Princeton University, Princeton, New Jersey 08544, USA
2 Thayer School of Engineering, Dartmouth College, Hanover, New Hampshire 03755, USA
Reprint requests to: David Wood, Department of Chemical Engineering, Princeton University, A417 Engineering Quadrangle, Olden Street, Princeton, NJ 08544, USA; e-mail: dwood{at}princeton.edu; fax: (609) 258-0211.
(RECEIVED December 18, 2004; FINAL REVISION February 7, 2005; ACCEPTED February 7, 2005)
| Abstract |
|---|
|
|
|---|
Keywords: protein purification; protein expression; polyhydroxybutyrate; intein; self-cleaving affinity tag
Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.041296305.
| Introduction |
|---|
|
|
|---|
One method that can simplify the purification of virtually any protein is the addition of an affinity tag sequence to the target protein gene (LaVallie and McCoy 1995). This gene fusion results in the expression of an affinity-tagged target protein that can easily be purified by exploiting the highly selective binding characteristics of the tag (Ford et al. 1991). Once the fusion protein is purified, the tag can be enzymatically removed by one of a number of protease enzymes (Fig. 1A
). This method thus provides a simple and reliable method for the purification of native target proteins, and has become a core technology in bioseparations at the research scale (Hearn and Acosta 2001; Terpe 2003). A recent advance in this field has been the development of self-cleaving affinity tags (Chong et al. 1997). These tags, based on a recently discovered self-splicing protein element known as an intein, eliminate the need for proteolytic processing of the purified fusion protein to acquire a native product. Furthermore, intein-based tags allow the cleaving reaction to take place on the affinity matrix itself, greatly simplifying the overall purification method (Wood et al. 2000; Xu and Evans 2001). The development of pH and temperature-controllable inteins has further improved the simplicity and economic advantages of this technology (Southworth et al. 1999; Wood et al. 1999).
|
In this study we use the unique properties of PHB in combination with a self-cleaving intein tag to create a simple, economic alternative for conventional affinity-based protein purification (Fig. 1B
). In this system, intracellular PHB granules are produced by E. coli cells to act as an affinity matrix for a coexpressed tagged protein. The affinity tag is derived from a class of PHB regulatory proteins known as phasins, which have been shown to exhibit strong and specific binding to the surface of the granules. During the fermentation, both granules and tagged proteins are coproduced in the E. coli cells. The tagged proteins adhere to the surface of the granules via the phasin tag. Once the cells are lysed, the granules are recovered and cleaned by repeated centrifugation and resuspension. The desired target protein is then released from the granules by pH-induced self-cleaving of the intein tag, allowing the affinity-purified native product to be easily separated from the granules and cleaved tags by a final centrifugation step. Tests on several target proteins indicate that this system is capable of providing highly purified active proteins at reasonable yields. Furthermore, the simple mechanical recovery of the PHB granules suggests a variety of means for trivial scaleup and transfer to other protein expression systems. The simplicity and self-contained nature of this system promise a significant breakthrough in the production of purified recombinant proteins for research and commercial use.
| Results |
|---|
|
|
|---|
-ketothiolase (encoded by the PhaA gene), a stereo-specific reductase (PhaB), and PHA synthase (PhaC), are necessary for transforming meta-bolic acetyl CoA to PHB and are encoded on plasmid pJM9131 (Zhang et al. 1994). Following published procedures for producing PHB in E. coli XL1-Blue (Pieper-Furst et al. 1995; Wieczorek et al. 1995; Maehara et al. 1999), several E. coli laboratory strains were transformed with pJM9131 and grown for 30 h in LB medium supplemented with 2% sodium lactate as a carbon source for PHB synthesis. Scanning electron microscopy images of iridium-coated dried cell lysates indicate the presence of granules of the expected size (~100700 nm) and characteristic shape absent in controls (Fig. 2
|
|
I-CM mini-intein, engineered from the splicing domain of the Mycobacterium tuberculosis (Mtu) recA intein to self-cleave upon application of a pH or temperature shift (Wood et al. 1999). C-terminal cleavage of the intein after expression of PPPI:M releases the maltose binding protein (M) from the triple-phasinintein (PPPI) complex. The PPPI:M fusion-protein gene was inserted into the T7 expression vector pET 21(+) to form pET/PPPI:M.
Double transformants carrying PHB biosynthesis genes (pJM9131) and the PPPI:M expression plasmid (pET/PPPI:M) were grown for 30 h in lactate-supplemented medium to produce PHB granules, at which point overexpression of the PPPI:M fusion protein was induced by IPTG addition. After an additional 4 h of incubation the cells were recovered by centrifugation and lysed by sonication into a pH 8.5 buffer. It has been shown (Wood et al. 1999) that the intein cleaving reaction is suppressed at this pH, allowing the precursor to be stabilized in an uncleaved form during subsequent granule wash steps. The soluble and insoluble fractions of the resulting cell lysates were separated by centrifugation and analyzed by SDS-PAGE (Fig. 4
, lanes 1,2). The insoluble pellet, containing the PHB granules and any bound proteins, was washed several times by repeated centrifugation and resuspension in fresh pH 8.5 buffer. The pH was then shifted to 6.0 in the final wash to initiate the intein self-cleavage reaction (Fig. 4
, lanes 3,5). Unclarified samples (including both soluble and insoluble material) were collected during the cleaving reaction and analyzed for cleavage product formation (Fig. 4
, lanes 710). Each of these samples was then clarified by centrifugation and the corresponding supernatant was analyzed to detect cleaved soluble product proteins (Fig. 5
, lanes 1114). The results indicate that during incubation over 25 h at 20°C the PPPI:M fusion protein cleaves to yield PPPI and M. As expected, PPPI is retained in the insoluble phase with the PHB granules, while M (MBP) is released into the soluble fraction. Activity of the purified MBP was subsequently confirmed by its affinity for maltose resin (Fig. 4
, lane 15). Similar results were obtained for the double phasin construct of PPI:M. The total MBP yield from this shake-flask experiment was 36.2 mg of MBP per L of culture (~3.35 mg per g of dry cell weight). Yields from similar experiments using PPI:M also fell within the range of 3540 mg per L of culture.
|
|
-galactosidase enzyme (PPI:
-gal; Fig. 5A
-gal, CAT, and NusA) with typical yields of 30 to 40 mg per L of culture (Table 1
-gal fraction (Fig. 5A
|
| Discussion |
|---|
|
|
|---|
-galactosidase (Fig. 4A
The successful purification of a target protein using this method is contingent on several additional factors. Obviously, the solubility of the tagged target protein plays a significant role, since proper folding and activity of the phasin tag and intein are critical to the purification process. In experiments where PPI:X fusion proteins were expressed in the absence of PHB production, it was observed that the solubility of the fusion generally reflected the solubility of the native product protein (X). Some of these data indicate that the addition of the phasin tags can somewhat decrease solubility in some proteins, although in many cases a highly soluble and active precursor can be produced easily. More importantly, addition of the phasin tag does not seem to affect the overall expression levels of any proteins tested. Finally, target proteins with specific affinity for PHB granules should also be avoided. For example, it has been reported that the
-lactamase enzyme exhibits selective affinity for PHB granules, and therefore competes with phasins in binding to PHB granules (Maehara et al. 1999). Although fusions of phasin intein
-lactamase could be recovered from cell lysates in our laboratory, much of the cleaved tag is displaced into the final soluble phase while a substantial amount of the cleaved
-lactamase remains bound to the PHB granules (data not shown).
An additional significant parameter that can affect the performance of this system is the salt concentration of the washing and cleaving buffers. Low-salt buffers (0 to 50 mM) increased protein yield for less soluble proteins (CAT, GFP, and
-lactamase) at the expense of purity (data not shown). In this case, leaching of nonphasin PHB-associated proteins into the final supernatant fraction was increased. High-salt buffers (150 to 1000 mM) reduced nonphasin impurities and increased yield for more soluble proteins (MBP, NusA, and
-gal) but also increased displacement of the phasinintein domain into the final soluble fraction. An intermediate salt content maintained the phasinintein fraction bound to PHB granules, reduced nonphasin impurity leakage into the soluble phase, and improved yield. Changes in other buffer components, such as concentrations of EDTA or DTT, or the buffering agents themselves, had minimal effects on system performance. This is typical of intein-based purification processes, and suggests that this system will be applicable to a wide variety of target proteins.
Advantages in comparison with other methods
This method has significant economic advantages in comparison with other affinity-tag systems because it eliminates the need for protease treatment to deliver a native product and it eliminates the cost associated with the affinity matrix itself. The conventional chitin resin associated with commercially available intein systems costs $192 per 100 mL (New England Biolabs), and has a nominal capacity of ~2 mg of target protein per mL of bed volume. Although this resin can be used several times, a regeneration procedure is required between each purification. With the PHB system described here, the initial cost of the resin is reduced to that of a simple carbon source supplement, and the resulting granules are effectively disposable.
The approach presented here also offers mild conditions for recovery of proteins and is largely independent of the product protein. The results presented in Figures 4
and 5
for MBP,
-gal, CAT, and NusA were obtained using the same conditions, expression variables, and buffer components. Risk of degradation and irreversible damage to the target protein is reduced, since this process includes no pH extremes, proteases, or denaturing reagents. Furthermore, the relatively mild mechanical separations associated with the process are unlikely to compromise the function of the cleaved target protein. This was verified with activity assays for both the maltose binding protein and
-galactosidase enzyme. In the case of poorly expressed proteins, where the ratio of desired target protein to contaminant is lower, this system has the usual advantages of general affinity separations. Because the contaminant proteins do not interact with the PHB, they are unlikely to impact the overall yield of the target. Indeed, lower expression of target protein may in some cases increase recovery due to reduced saturation of the PHB granule surface with uncleaved fusion protein.
Although experiments presented here were carried out in E. coli, this method is applicable to protein purification in any protein expression system capable of synthesizing PHB. These include Ralstonia eutropha (York et al. 2001), Paracoccus denitrificans (Maehara et al. 1999), Baccillus megaterium (McCool and Cannon 1999), Rhodococcus ruber (Pieper-Furst et al. 1995), cotton (John and Keller 1996), and many others (Madison and Huisman 1999). These organisms could each offer specific advantages in expressing recombinant proteins, such as reducing inclusion body formation, improving glycosylation, or increasing fermentation cell density as demonstrated for Ralstonia eutropha (Srinivasan et al. 2002). Hence, the potential of the method presented here and its impact on protein purification encompasses genetic and experimental advances made in working with numerous organisms. In addition to a number of options for expression host organisms, a variety of carbon sources can also be used as the feed for PHB production. Although lactate was used as the supplemental carbon source in this case, other carbon sources such as glucose, sucrose, fructose, xylose, and whey have also been used for producing PHAs (Zhang et al. 1994; Ahn et al. 2000).
Future improvements
The data presented in this study are derived from simple proof-of-principle experiments, and generally indicate reasonable purity at relatively low concentration. It is anticipated that substantial purity and yield at high concentration will require significant optimization with regard to process design and operation, and may require additional subsequent steps. In cases where extremely high purity is necessary, as with pharmaceutical products, additional purification of the cleaved product protein will undoubtedly be required. We therefore expect that this system will find use in the large-scale production of inexpensive proteins with moderate purity requirements, or as a first-capture step to simplify the early purification of more highly specialized products. In either case, the simplicity of the system is likely to find utility in the production and purification of a variety of products.
Product protein yield is dependent on PHB granule production and morphology. PHB granules should be large enough to separate by trivial mechanical means and yet small enough to offer the maximum surface area for capturing and binding tagged product protein fusions. It has been speculated that phasin expression is correlated to an increase in number and decrease in size of PHB granules (Maehara et al. 1999). It is likely that independent control of PHB production and phasin- tagged fusion expression will allow significant yield increases over the initial results reported here.
Other factors which could improve the yield include: phasinintein linker length and phasin structure. Depending on the mechanism and conformation of phasin association with PHB, which is still unclear, varying the linker length can lead to closer packing of fusion molecules on the PHB surface. The phasin sequence used here contains 191 amino acids with 46 alanine residues. In addition, of the 28 C-terminal amino acids, 14 are alanine and 7 are threonine residues. Perhaps a smaller phasin could be engineered to provide the same or greater affinity for PHB and hence reduce the total fusion size for higher efficiency.
We have introduced a protein purification process in which the host cells, in this case E. coli, produce an affinity tagged product protein and an easily recovered affinity carrier. The self-cleaving capability of the affinity tag allows the simple recovery of a native target protein at reasonable yield and very low cost. This simple technique is likely to be portable to numerous other expression hosts and is a significant advance in the large-scale production of recombinant protein products.
| Materials and methods |
|---|
|
|
|---|
M15 Tn10(TetR)]) from Stratagene; ER2566 (F lamda fhuA2 [Ion] ompT lacZ::T7 gene1 gal sulA11 D(mcrC-mrr)114::IS10 R(mcr- 73::miniTn10TetS)2 R(zgb-210::Tn10)(TetS) endA1[dcm]) from NEB; BL21 (DE3) (F ompT hsdISB (rBmB) gal dcm(DE3)) and BLR (DE3) (F ompT hsdSB (rBmB) gal dcm (DE3)
(srl-recA)306::Tn10 (TetR)) from Novagen were used for cloning and expression using standard techniques (Sambrook and Russell 2001). Plasmids pJM9131 (KanR) containing the phaCAB operon for PHB biosynthesis and phaK (CamR) containing the phasin phaP gene were kindly provided by Professor Douglas Dennis (Arizona State University, West Campus, Phoenix) and are described elsewhere (Slater et al. 1992; Zhang et al. 1994; Kidwell et al. 1995). Plasmid pET-21(+) (AmpR) from Novagen featuring the T7lac promoter was used for expression and modified by adding a PCR amplified product to include a ribosome binding site and the maltose binding domain (from the pMAL plasmid, New England Biolabs) between the BamHI and EcoRI sites. After sequence and expression verification for the maltose binding domain (MBD), MBD was replaced by a phasin sequence using NdeI (introduced by the MBD PCR) and EcoRI. The phasin was followed by this linker sequence: AACAATAACAACAACCTCGGGATCGAGGGAAGGAT TTCAGAATTC. An additional phasin with two flanking NdeI sites was PCR amplified and inserted upstream of the initial phasin. In the case of the triple phasin constructs PCR amplification was again used to generate a third phasin with two flanking EcoRI sites for insertion downstream of the first phasin. PCR amplifications were carried out such that the linker sequence mentioned above followed each inserted phasin in the final construct. The mutated and evolved mini-intein from M. tuberculosis (Mtu) recA was digested out of a previous plasmid pM
I
T-CM (Wood et al. 1999) using EcoRI and BsrGI and was inserted downstream of the phasin sequences. The maltose binding domain or other target protein domains, NusA,
-gal, and CAT, were PCR amplified flanked by BsrGI and HindIII or NotI and inserted downstream from the intein. The NusA gene came from the pET-43.1 vector available from Novagen.
-Gal was PCR amplified from E. coli chromosome and CAT from the phaK plasmid carrying the CamR gene.
Media, expression and PHB generation
Strains carrying pJM9131 and producing PHB were diluted 100:1 from overnight cultures and grown for 30 h at 37°C (unless otherwise noted) in Luria-Bertani medium (1% Bacto tryptone, 0.5% yeast extract, and 1% NaCl) supplemented with 2% sodium lactate and 50 µg/mL kanamycin. In the case of double transformants carrying a modified pET-21 vector expressing a fusion protein (such as pET/PPPI:M) the media was additionally supplemented with ampicillin (100 µg/mL). All growth steps were carried out in shake flasks or 5-mL test tubes in a Labline orbital shaker at 300 rpm. Isopropyl-
- D-thiogalactopyranoside (IPTG) was added for inductions and cultures grown for an additional 4 to 8 h at 37°C or 20°C as indicated, at which point the cells were harvested by centrifugation (5000g, 10 min, 4°C).
Scanning electron micrographs
Modifying a previously described method (Doi 1990), 1-mL samples grown as described above (in LB+2% lactate for 30 h) were resuspended in 100 µL lysozyme-containing lysis buffer (10 mM Tris-HCl, 10 mM CaCl2, 0.5 mg/mL lysozyme) before adding 100 µL of an alkaline-SDS solution (0.4 M NaOH, 2% SDS). Four 15-sec sonications were carried out on ice allowing the samples to cool intermediately. Samples were dried on carbon tab specimen mounts (Ted Pella) and sputtered with a 2-nm layer of iridium before being examined using a Philips XL30 FEG-SEM under a 5-KeV beam.
Purification and SDS-PAGE analysis
Harvested cell pellets from 1-mL samples were resuspended in 300 µL modified lysis buffer (20 mM Tris, 20 mM Bis, 50 mM NaCl, 1 mM DTT, 2 mM EDTA, 0.25 mg/100 mL lyzozyme, at pH 8.5) and disrupted by ultrasonic disruption at 4°C. Lysed cells were spun in a bench-top centrifuge at 14,000g for 1030 min at 4°C. Supernatant was then discarded and the cells resuspended in a wash buffer (20 mM Tris, 20 mM Bis, 50 mM NaCl, 1 mM DTT, 2 mM EDTA, at pH 8.5). Resuspended pellet was centrifuged at 14,000g for 1030 min at 4°C and the wash discarded. This wash step was repeated as necessary. In the last wash cycle, the pellet was resuspended in a cleavage buffer (20 mM Tris, 20 mM Bis, 50 mM NaCl, 1 mM DTT, 2 mM EDTA, at pH 6.5 or pH 6.0) and centrifuged at 14,000g for 1030 min at 4°C and the supernatant discarded. This was to ensure homogenous pH throughout the pellet and the tube. The pellet was resuspended again in the cleavage buffer and left to rest at room temperature (1823°C) for cleavage. At each time point a total solution fraction was taken and the sample centrifuged at 14,000g for 1030 min at 4°C to take a supernatant (soluble) fraction. Samples were resuspended after taking the supernatant time point and left to rest at 1823°C for the cleavage to continue to completion. Samples were analyzed by 12% SDS-PAGE followed by staining with Coomassie Brilliant Blue G-250.
Protein content quantification and
-gal activity assay
Protein concentrations were measured using the Bradford method (Ausubel 1998).
-Galactosidase activity assay based on activity with o-Nitrophenyl-
-D-galactopyranoside (ONPG) was measured by the
-gal Activity Assay kit by Stratagene.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Anderson, A.J. and Dawes, E.A. 1990. Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev. 54: 450472.
Ausubel, F.M. 1998. Protein analysis. In Current protocols in molecular biology (eds. F.M. Ausubel et al.), Section 10.11.14. John Wiley & Sons, New York.
Chong, S., Mersha, F.B., Comb, D.G., Scott, M.E., Landry, D., Vence, L.M., Perler, F.B., Benner, J., Kucera, R.B., Hirvonen, C.A., et al. 1997. Single-column purification of free recombinant proteins using a self-cleavable affinity tag derived from a protein splicing element. Gene 192: 271281.[CrossRef][Medline]
Doi, Y. 1990. Fermentation and analysis of microbial polyesters. In Microbial polyesters, p. 156. VCH, New York.
Fidler, S. and Dennis, D. 1992. Polyhydroxyalkanoate production in recombinant Escherichia coli. FEMS Microbiol. Rev. 9: 231235.[Medline]
Ford, C.F., Suominen, I., and Glatz, C.E. 1991. Fusion tails for the recovery and purification of recombinant proteins. Protein Expr. Purif. 2: 95107.[CrossRef][Medline]
Freitag, R. and Horvath, C. 1996. Chromatography in the downstream processing of biotechnological products. Adv. Biochem. Eng. Biotechnol. 53: 1759.[Medline]
Hahn, J.J., Eschenlauer, A.C., Sleytr, U.B., Somers, D.A., and Srienc, F. 1999. Peroxisomes as sites for synthesis of polyhydroxyalkanoates in transgenic plants. Biotechnol. Prog. 15: 10531057.[CrossRef][Medline]
Hearn, M.T. and Acosta, D. 2001. Applications of novel affinity cassette methods: Use of peptide fusion handles for the purification of recombinant proteins. J. Mol. Recognit. 14: 323369.[CrossRef][Medline]
John, M.E. and Keller, G. 1996. Metabolic pathway engineering in cotton: Biosynthesis of polyhydroxybutyrate in fiber cells. Proc. Natl. Acad. Sci. 93: 1276812773.
Kidwell, J., Valentin, H.E., and Dennis, D. 1995. Regulated expression of the Alcaligenes eutrophus pha biosynthesis genes in Escherichia coli. Appl. Environ. Microbiol. 61: 13911398.[Abstract]
LaVallie, E.R. and McCoy, J.M. 1995. Gene fusion expression systems in Escherichia coli. Curr. Opin. Biotechnol. 6: 501506.[CrossRef][Medline]
Leaf, T.A., Peterson, M.S., Stoup, S.K., Somers, D., and Srienc, F. 1996. Saccharomyces cerevisiae expressing bacterial polyhydroxybutyrate synthase produces poly-3-hydroxybutyrate. Microbiology 142(Pt 5): 11691180.[Abstract]
Lee, S.Y. 1996. Bacterial Polyhydroxyalkanoates. Biotechnol. Bioeng. 49: 114.[CrossRef]
Madison, L.L. and Huisman, G.W. 1999. Metabolic engineering of poly(3- hydroxyalkanoates): From DNA to plastic. Microbiol. Mol. Biol. Rev. 63: 2153.
Maehara, A., Ueda, S., Nakano, H., and Yamane, T. 1999. Analyses of a polyhydroxyalkanoic acid granule-associated 16-kilodalton protein and its putative regulator in the pha locus of Paracoccus denitrificans. J. Bacteriol. 181: 29142921.
McCool, G.J. and Cannon, M.C. 1999. Polyhydroxyalkanoate inclusion body-associated proteins and coding region in Bacillus megaterium. J. Bacteriol. 181: 585592.
Pieper-Furst, U., Madkour, M.H., Mayer, F., and Steinbuchel, A. 1995. Identification of the region of a 14-kilodalton protein of Rhodococcus ruber that is responsible for the binding of this phasin to polyhydroxyalkanoic acid granules. J. Bacteriol. 177: 25132523.
Sambrook, J. and Russell, D.W. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Slater, S., Gallaher, T., and Dennis, D. 1992. Production of poly-(3-hydroxybutyrate- co-3-hydroxyvalerate) in a recombinant Escherichia coli strain. Appl. Environ. Microbiol. 58: 10891094.
Southworth, M.W., Amaya, K., Evans, T.C., Xu, M.Q., and Perler, F.B. 1999. Purification of proteins fused to either the amino or carboxy terminus of the Mycobacterium xenopi gyrase A intein. Biotechniques 27: 110120.[Medline]
Srinivasan, S., Barnard, G.C., and Gerngross, T.U. 2002. A novel highcell- density protein expression system based on Ralstonia eutropha. Appl. Environ. Microbiol. 68: 59255932.
Terpe, K. 2003. Overview of tag protein fusions: From molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60: 523533.[CrossRef][Medline]
Wieczorek, R., Pries, A., Steinbuchel, A., and Mayer, F. 1995. Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus. J. Bacteriol. 177: 24252435.
Wood, D.W., Wu, W., Belfort, G., Derbyshire, V., and Belfort, M. 1999. A genetic system yields self-cleaving inteins for bioseparations. Nat. Biotechnol. 17: 889892.[CrossRef][Medline]
Wood, D.W., Derbyshire, V., Wu, W., Chartrain, M., Belfort, M., and Belfort, G. 2000. Optimized single-step affinity purification with a selfcleaving intein applied to human acidic fibroblast growth factor. Biotechnol. Prog. 16: 10551063.[CrossRef][Medline]
Xu, M.Q. and Evans Jr., T.C. 2001. Intein-mediated ligation and cyclization of expressed proteins. Methods 24: 257277.[CrossRef][Medline]
York, G.M., Junker, B.H., Stubbe, J.A., and Sinskey, A.J. 2001. Accumulation of the PhaP phasin of Ralstonia eutropha is dependent on production of polyhydroxybutyrate in cells. J. Bacteriol. 183: 42174226.
Zhang, H., Obias, V., Gonyer, K., and Dennis, D. 1994. Production of polyhydroxyalkanoates in sucrose-utilizing recombinant Escherichia coli and Klebsiella strains. Appl. Environ. Microbiol. 60: 11981205.
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
L. Neumann, F. Spinozzi, R. Sinibaldi, F. Rustichelli, M. Potter, and A. Steinbuchel Binding of the Major Phasin, PhaP1, from Ralstonia eutropha H16 to Poly(3-Hydroxybutyrate) Granules J. Bacteriol., April 15, 2008; 190(8): 2911 - 2919. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hanisch, M. Waltermann, H. Robenek, and A. Steinbuchel The Ralstonia eutropha H16 phasin PhaP1 is targeted to intracellular triacylglycerol inclusions in Rhodococcus opacus PD630 and Mycobacterium smegmatis mc2155, and provides an anchor to target other proteins. Microbiology, November 1, 2006; 152(Pt 11): 3271 - 3280. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Brockelbank, V. Peters, and B. H. A. Rehm Recombinant Escherichia coli Strain Produces a ZZ Domain Displaying Biopolyester Granules Suitable for Immunoglobulin G Purification Appl. Envir. Microbiol., November 1, 2006; 72(11): 7394 - 7397. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Peters and B. H. A. Rehm In vivo enzyme immobilization by use of engineered polyhydroxyalkanoate synthase. Appl. Envir. Microbiol., March 1, 2006; 72(3): 1777 - 1783. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |