HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dyer, D. H. Articles by Fox, B. G. Search for Related Content PubMed PubMed Citation Articles by Dyer, D. H. Articles by Fox, B. G. Social Bookmarking                   What's this?

X-ray structure of putative acyl-ACP desaturase DesA2 from Mycobacterium tuberculosis H37Rv

Department of Biochemistry, University of Wisconsin, Madison, Madison, Wisconsin 53706, USA

Reprint requests to: Brian G. Fox, Department of Biochemistry, 433 Babcock Dr., University of Wisconsin, Madison, Madison, WI 53706, USA; e-mail: bgfox{at}biochem.wisc.edu; fax: (608) 262-3453.

(RECEIVED December 13, 2004; FINAL REVISION February 10, 2005; ACCEPTED February 11, 2005)

	Abstract

TOP Abstract Introduction Results Discussion Materials and methods References

 
Genome sequencing showed that two proteins in Mycobacterium tuberculosis H37Rv contain the metal binding motif (D/E)X₂HX_~100(D/E)X₂H characteristic of the soluble diiron enzyme superfamily. These putative acyl-ACP desaturase genes desA1 and desA2 were cloned from genomic DNA and expressed in Escherichia coli BL21(DE3). DesA1 was found to be insoluble, but in contrast, DesA2 was a soluble protein amenable to biophysical characterization. Here, we report the 2.0 Å resolution X-ray structure of DesA2 determined by multiple anomalous dispersion (MAD) phasing from a Se-met derivative and refinement against diffraction data obtained on the native protein. The X-ray structure shows that DesA2 is a homodimeric protein with a four-helix bundle core flanked by five additional helices that overlay with 192 structurally equivalent amino acids in the structure of stearoyl-ACP 9 desaturase from castor plant with an rms difference 1.42 Å. In the DesA2 crystals, one metal (likely Mn from the crystallization buffer) was bound in high occupancy at the B-site of the conserved metal binding motif, while the A-site was not occupied by a metal ion. Instead, the amino group of Lys-76 occupied this position. The relationships between DesA2 and known diiron enzymes are discussed.

Keywords: desaturase; Mycobacterium tuberculosis; X-ray crystallography

Abbreviations: A cis -5–24:1 fatty acid is a C₂₄ molecule with one cis double bond at the C–5 position • a cis-³, cis-¹⁵-34:2 fatty acid is a C₃₄ molecule with two cis double bonds at the C–3 and C–15 positions • IPTG, isopropyl--D-thiogalactopyranoside • SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis • OD₆₀₀, optical density at 600 nm • MAD, multiple anomalous dispersion • rms, root mean square.

Article and publication are at http://www.proteinscience.org/cgi/doi/10.1110/ps.041288005.

	Introduction

TOP Abstract Introduction Results Discussion Materials and methods References

 
The acyl-ACP desaturases are one of the major functional classes of soluble diiron enzymes (Fox et al. 2004). Genome sequencing has suggested that Mycobacterium tuberculosis and related organisms also contain acyl-ACP desaturase-like proteins (Cole et al. 1998). This finding has intriguing biochemical implications, as all mycobacteria have an outer cell wall containing an extensively modified long-chain fatty acid complex called mycolic acid (Barry et al. 1998). This waxy coating provides a protective barrier against macrophage attack, desiccation, water-soluble antibiotics, and other antimicrobial agents. A widely attributed hypothesis is that the biosynthesis of mycolic acid requires desaturases to form precursors with position-specific double bonds (Yuan et al. 1995; Dubnau et al. 2000). Subsequent modifications of the double bonds allow position-specific cyclopropanation, epoxidation, hydroxylation, methoxylation, and ketonization. Therefore, desaturation is likely an essential step in the biosynthesis of structurally and chemically diverse mycolic acids.

Here we report studies of the DesA1 and DesA2 proteins from M. tuberculosis H37Rv produced in Escherichia coli, annotated as putative acyl-ACP desaturases. DesA1 was not expressed as a soluble protein in E. coli, but DesA2 was obtained in sufficient quantities to initiate further studies. The X-ray structure of DesA2 supports assignment to the acyl-ACP desaturase structural family, but also reveals several differences with known diiron enzymes. Notably, the structure reveals that the N group of a Lys residue occupies the position expected to contain a metal ion of the diiron center. Furthermore, two extended sequences of disordered residues apparently occupy an interface between subunits of the otherwise well ordered 2.0 Å resolution structure. These differences introduce new questions about structural variations within the Pfam family assigned to the acyl-ACP desaturases.

	Results

TOP Abstract Introduction Results Discussion Materials and methods References

 
Phylogenetic analysis
Figure 1 compares the amino acid sequences of DesA2 (annotated desA2, rv1094) and DesA1 (desA1, rv0824c) from M. tuberculosis H37Rv with the stearoyl-acyl carrier protein 9 desaturase (9D) from castor (Ricinus communis; Shanklin and Somerville 1991) and the model plant Arabidopsis thaliana (The Arabidopsis Genome Initiative 2000). The DesA2 protein is 275 residues long, while DesA1 and the two plant desaturases are ~350 residues long. The gray shading shows residues from the metal binding motif (D/E)X₂HX_~100(D/E)X₂H found in all representatives of the soluble diiron superfamily (Fox et al. 1994). The arrow in Figure 1 shows a conserved Trp residue implicated in electron transfer in other diiron enzymes, while boxes indicate other conserved residues whose positions and identities will be addressed after presentation of the DesA2 structure.

View larger version (61K): [in this window] [in a new window]   Figure 1. Sequence alignment of acyl-ACP desaturases. Putative desaturases from M. tuberculosis H37Rv are aligned with the stearoyl-ACP 9 desaturases from castor (Ricinus communis) and Arabidopsis thaliana. The alignment was produced using CLUSTAL W (Thompson et al. 1994) as implemented in LaserGene (version 5.52, DNASTAR). Conserved residues are identified by boxes, residues lining the proposed substrate binding tunnel of 9D are identified by•, diiron cluster ligands are identified by gray shading, residues providing hydrogen bonds to the N2 positions of the His ligands are identified by , and Trp residues implicated in electron transfer are identified by the arrow.

Purification
The purification procedure used for DesA2 consisted of ion exchange and gel filtration chromatographies, and gave ~13 mg of purified protein per g of wet cells. Upon the basis of calibrated gel filtration measurements, the elution time observed for DesA2 was consistent with the protein being a dimer in solution. MALDI-TOF mass spectral analysis revealed that the unlabeled, purified protein had molecular masses of 31,138 m/z and 31,345 m/z, which closely matched the values calculated from the gene sequence for protein lacking and retaining the N-terminal methionine, respectively. Furthermore, ESI-MS analysis of the selenomethionine-labeled DesA2 indicated that >95% substitution at the three internal methionine sites was achieved. The purified DesA2 exhibited no significant optical chromophores in the visible range, such as might be expected from an oxo-bridged diiron center near 340 nm (Fox et al. 1994). Furthermore, colorimetric metal analysis revealed substoichiometric quantities of Fe, ~0.2 mol per mol of polypeptide, compared to the anticipated ~2 mol per mol of polypeptide expected for a diiron enzyme such as 9D (Fox et al. 1993).

Crystallization and structure statistics
Crystals of DesA2 grew from light precipitate as elongated hexagonal bipyramids which attained a size of 0.7 x 0.2 x 0.2 mm within 24 h. They belong to space group P6₅22, with unit-cell parameters a=b=65.8 Å, c=292.0 Å. Table 1 shows the data collection and processing statistics obtained for DesA2, while Table 2 shows the refinement statistics. The final R-factor and R_free were 0.206 and 0.236 for the 24,420 unique reflections observed between 56.8 and 2.0 Å (96.8% complete). The bond lengths and bond angles of the refined atoms had rms deviation from the ideal values of 0.022 Å and 1.63°, respectively.

View larger version (40K): [in this window] [in a new window]   Figure 2. A stereoview of representative electron density. The map was calculated with coefficients of the form 2Fo-Fc and was contoured at 1 . The region in the protein around conserved residues Trp-32, Asp-188, and His-110 is shown. Figure was prepared with the program MacPyMOL (DeLano 2003).

View larger version (66K): [in this window] [in a new window]   Figure 3. Ribbon diagram of DesA2. Residues Met-1 to Ala-7, Leu-79 to Glu-93, and Gln-135 to Glu-144 were not observed. The position of N-terminal Asp-8 is indicated. Hypothetical connectivity indicated by dotted lines. The C-terminal residue Gly-275 was not observed. The location of a single metal ion per protein subunit is also indicated. The -helical secondary structure elements described in the Results section are marked on one side of the dimer.

View larger version (24K): [in this window] [in a new window]   Figure 4. A stereo representation of the metal bound in DesA2 and closely associated residues. Ligands to the metal are Glu-107, Glu-159, Glu-189, and His-192. Glu-107, His-110, and Glu-189 are within hydrogen bonding distance of N of Lys-76.

	Discussion

TOP Abstract Introduction Results Discussion Materials and methods References

 
Acyl-ACP desaturase superfamily
The acyl-ACP desaturases are members of Pfam PF03405, which presently contains 78 nonredundant examples. These enzymes were first identified in plants, and the majority of efforts have focused on stearoyl-ACP ⁹ desaturase (9D). This enzyme has been cloned from the castor plant (Ricinus communis; Shanklin and Somerville 1991) and expressed in E. coli (Fox et al. 1993; Hoffman et al. 1995). The X-ray structure of the castor enzyme was solved at ~2.4 Å resolution (Lindqvist et al. 1996; Moche et al. 2003). The fold of the central -helical bundle has high similarity to ribonucleotide reductase (Nordlund and Eklund 1993), methane monooxygenase (Rosenzweig et al. 1993; Elango et al. 1997), toluene/o-xylene monooxygenase (Sazinsky et al. 2004), and ferretin (Takagi et al. 1998). In these proteins, the aspartate, glutamate, and histidine residues of the conserved metal binding motif (D/E)X_~40(D/E)X₂HX_~60 (D/E)X_~40(D/E)X₂H provide ligands to the catalytically essential diiron center.

Genome sequencing revealed three genes with similarity to known fatty acid desaturases (Cole et al. 1998). One of these, DesA3, was assigned to be an integral membrane desaturase and was more recently characterized by heterologous expression in E. coli to function as a stearoyl-CoA ⁹ desaturase (Phetsuksiri et al. 2003). Thus DesA3 appears to be functionally analogous to the intensively studied mammalian stearoyl-CoA desaturase (Ntambi 1995), which has a number of important physiological roles in cells (Ntambi 1995; Ntambi et al. 2002). DesA3 was recently shown to be essential for the viability of M. tuberculosis, and was identified as a target of the long-known anti-tuberculosis drug isoxyl (Phetsuksiri et al. 2003).

Two other genes from M. tuberculosis H37Rv, desA1 and desA2, were annotated to encode putative acyl-ACP desaturase homologs DesA1 and DesA2 (Cole et al. 1998). Other organisms identified by Pfam analysis to have these putative desaturases include Mycobacterium tuberculosis strain CDC1551, Mycobacterium avium sub-species paratuberculosis, Mycobacterium leprae, Mycobacterium bovis, Mycobacterium smegmatis, Streptomyces colieocolor, and Streptomyces avermitilis. Albeit with the limited number of examples available, the DesA1 proteins have ~82% amino acid sequence identity, while the DesA2 proteins have ~75% amino acid sequence identity. In contrast, the mycobacterial proteins share only ~20% identity with the plant acyl-ACP desaturases. DesA1 is ~338 residues long, which is closer in size to the plant acyl-ACP desaturases (~350 residues). Moreover, DesA1 has a Glu-76/Asp-77 pattern in the diiron sequence motif at the Fe_A ligand, which is consistent with that observed in the plant acyl-ACP desaturases (Glu-105/Glu-106 in mature castor 9D, but Glu-130/Asp-131 in the full-length A. thaliana protein; see Fig. 1). In contrast, DesA2 is only 275 residues long and has the Lys-76/Asp-77 motif pattern at the Fe_A ligand.

DesA2 structure
Figure 5 shows a schematic comparison of DesA2 and 9D. Visual inspection reveals that these two structures are related, even though DesA2 is a considerably smaller protein. Indeed, when superimposed with Align (Cohen 1997) the tertiary structures of DesA2 and castor 9D have an rms difference between 192 structurally equivalent amino acids of only 1.42 Å . Even more striking is the similarity in the DesA2 structure (Lys-145 to Leu-263) following the regions of disorder compared to 9D (Glu-182 to Val-310), where the rms difference between 114 structurally equivalent amino acids is 1.23 Å . This demonstrates the remarkable structural similarity between the plant and bacterial proteins in light of their limited sequence identity of ~24%.

View larger version (42K): [in this window] [in a new window]   Figure 5. Comparison of X-ray structures. DesA2 (A; this work) and 9D (B; Lindqvist et al. 1996).

Metal binding motif and disposition of metal center in DesA2
The identity and spacing of the first ligand provided by the diiron metal binding motif are variable among the known diiron enzymes. A variety of studies of soluble diiron enzymes have implicated the Fe_A site, bound by this first, variable ligand, to have a leading role in catalysis including proximity to the Tyr-122 radical (Nordlund and Eklund 1993), stabilization of peroxodiiron(III) state (Baldwin et al. 2001) in ribonucleotide reductase, and alterations of product distributions for regiospecific toluene hydroxylation upon mutagenesis of immediately adjacent residues (Mitchell et al. 2002). Since all sequences of DesA2 available from clinical isolates of M. tuberculosis and other organisms have a Lys residue at the position corresponding to Lys-76, it is likely that this amino acid residue has a unique role in the presently unknown function of DesA2.

The DesA2 crystal structure has only one metal bound per subunit (likely Mn²⁺ from the crystallization buffer), while the position comparable to that occupied by a second metal in other diiron enzymes is occupied by the N atom of Lys-76. A Lys amino group has not been observed as a ligand in an iron-containing protein, and this residue would be expected to be a poor ligand at physiologic pH or the slightly acidic conditions of the crystallization experiment. One disordered sequence of DesA2 begins immediately after Lys-76, which may be attributed to a rearrangement caused by N of Lys-76 occupying the putative second metal binding site. Also, sequence alignments indicate that this region is shorter in DesA2, suggesting the possibility of an altered route for access to the metal center in DesA2. It is plausible that substrate binding or other presently unknown biochemical factors unique to mycobacteria may assist in assembly of a dimetallic site in this protein. This functional relationship is also suggested by the conservation of a hydrogen-bonding pathway involving Trp-32, Asp-188, and putative metal ligand His-110 that has been implicated in electron transfer in ribonucleotide reductase (Fig. 2). However, it is also possible that DesA2 may have evolved away from a function requiring a bimetallic center to some other function, which remains to be determined.

Role of desaturases in Mycobacteria
Acyl-ACPs are the only relevant physiological substrates of 9D (Broadwater et al. 1998; Haas and Fox 1999; Lyle et al. 2003), and many aspects of catalysis likely arise from the influence of extensive enzyme-substrate interactions (Bloch 1969; Fox et al. 2004). Figure 2 shows the positions of 14 residues identified to line the bent tunnel in 9D, presumably at the correct depth from the surface to positions C–9 and C–10 of the 18:0 moiety of 18:0-ACP for reaction (Lindqvist et al. 1996). DesA2 has a different residue than the other proteins at 11 of 14 of these positions, including changes in size and polarity. Moreover, DesA2 has two well-ordered residues placed over and into an internal cavity near the putative metal binding site (Val-224 and Leu-225). Access to this cavity would apparently require conformational change, perhaps induced by substrate binding, metal incorporation, or some other effect.

Mass spectral analysis of mycolic acids from M. tuberculosis H37Rv suggested that 24:0 is desaturated to cis-⁵-24:1, chain-elongated, and then desaturated to form cis-³, cis-¹⁵-34:2 as intermediates of mycolic acid biosynthesis (Watanabe et al. 2002). There is also evidence that AcpM acts as the specialized long acyl chain carrier in this process. AcpM shares similarity in primary sequence and tertiary structure with other known ACPs (Holak et al. 1988; Kim and Prestegard 1989; Crump et al. 1997; Xu et al. 2001; Li et al. 2003). However, AcpM contains an elongated C-terminal (~35 amino acids), which forms a flexible extension from the conserved fold of the ACP (Wong et al. 2002). Although the function of this unique extension is not known, these 35 amino acids are postulated either to sequester the long acyl chain or to mediate interactions with specific enzymes (Wong et al. 2002). The potential involvement of acyl-AcpM desaturases in mycolic acid biosynthesis implies differences in the architecture of the substrate binding channel used for a cis-⁵-24:0 or a cis-¹⁵-34:1-³ desaturation compared to a cis-18:0-⁹ desaturation. It also implies differences in the protein interactions required for formation of the enzyme-substrate complex due to the structural features of AcpM. The differences in structure observed for DesA2 and 9D, particularly the extent of disorder in the intersubunit region, which also closely approaches the metal center region, are a tantalizing indication that structural differences may be associated with functional differences.

Conclusions
The present crystallographic results provide evidence that DesA2 is structurally related to the plant acyl-ACP desaturases. However, the differences in the variable Fe_A region and the extent of disorder in the intersubunit region observed with DesA2 suggest different capabilities for this mycobacterial variant. As recent gene disruption studies have suggested that DesA2 is essential for the viability of pathogenic mycobacteria (gene disruption studies and attempts to introduce conditional mutations in DesA2 indicate that loss of function of either of these proteins is associated with an inability to recover viable mycobacteria; M. Jackson and P.J. Brennan, unpubl.), further studies of the unique properties of this putative desaturase are clearly needed.

	Materials and methods

TOP Abstract Introduction Results Discussion Materials and methods References

 
Materials
M. tuberculosis H37Rv total genomic DNA was obtained from the Tuberculosis Research Materials Facility at Colorado State University (Prof. J. Belisle, Director, NIH NIAD NO1AI75320). Vent DNA polymerase was from New England Biolabs. Oligonucleotide primers were obtained from Integrated DNA Technologies. The E. coli strain DH5 [sup E44lacU169(80lacZM15)hsdR17recA1 endA1 gyrA96 thi-1 relA1] was used for cloning purposes. The E. coli strain BL21(DE3) [F^– ompT hsdS_B (r_B–m_B–) gal dcm (DE3)] was used as the protein expression host. Gateway Entry and Destination vectors and recombinase were from Invitrogen.

Cloning methods
M. tuberculosis H37Rv genomic DNA was used as a template for PCR. For the rv0824c gene (DesA1), the forward oligonucleotide primer contained the sequence 5'-atggcacagaaacctgtcgct gatg, which began with the annotated start codon. The reverse primer contained the sequence 5'-ctagcccgtgacgaattgcttgagg. For the rv1094 gene (DesA2), the forward oligonucleotide primer contained the sequence 5'-atggcacagaaacctgtcgctgatg, which began with the annotated start codon. The reverse primer contained the sequence 5'-ctagcccgtgacgaattgcttgagg. The PCR contained 10% dimethyl sulfoxide (DMSO) and consisted of 29 cycles of melt, anneal, and extend at temperatures of 94°C, 59°C, and 72°C, respectively. The resulting DNA fragments were purified by gel electrophoresis and extracted using a QIAquik Gel Extraction Kit (QIAGEN). The attB DNA recombination sequences were introduced into the 5' and 3' ends of the amplified genes by PCR. For the rv0824c gene, the forward primer 5'-ggggacaagtttgtacaaaaaagcaggctgaaggagatatacatatgg cacagaaacctgtcgctg and the reverse primer 5'-ggggaccactttgta caagaaagctgggtctagcccgtgacgaattgcttgagg were used. For the rv1094 gene, the forward primer 5'-ggggacaagtttgtacaaaaaag caggctgaaggagatatacatatggcacagaaacctgtcgctg and the reverse primer 5'-ggggaccactttgtacaagaaagctgggtctagcccgtgacgaattgctt gagg were used. The resulting ~1-kb DNA fragments were purified by gel electrophoresis followed by extraction with the QIAquik kit (QIAGEN). The fragments were inserted into a Gateway Entry vector (pDONR221) containing attP sites using the BP Clonase enzyme mix. This reaction created entry plasmids containing attL sites flanking both ends of the cloned gene sequence. CaCl₂ competent E. coli DH5 (Sambrook et al. 2001) were transformed by heat shock with 1 µL of the BP reaction, and the transformation mixture was plated onto Luria-Bertani agar plates containing 50 µg/mL of kanamyacin. Plasmids were isolated from kanamyacin-resistant transformants using a QIAprep Spin MiniPrep kit (QIAGEN). The LR Clonase enzyme mix was used in a recombination reaction between the attL sites of the entry clones and the attR sites of a Gateway pDEST-14 vector. This recombination created an expression plasmid with the gene of interest under control of the viral T7 RNA polymerase promoter. E. coli DH5 cells were transformed with the reaction mixture and plated onto Luria-Bertani agar plates containing 200 µg/mL ampicillin. Plasmids from ampicillin-resistant transformants were purified using a QIAprep Spin Mini-Prep kit. Big Dye DNA sequencing (version 3.1, Applied Biosystems) performed at the University of Wisconsin Biotechnology Center was used to verify the coding sequence of the expression plasmids. The sequence-verified expression plasmids were named pKLDES1-a and pKLDES2-a.

Expression experiments
E. coli BL21(DE3) was transformed by electroporation with 1 µL of ~100 µg/mL plasmid DNA and plated onto Luria-Bertani agar plates (Sambrook et al. 2001) containing 200 µg/mL ampicillin. After ~16 h, a single colony was aseptically transferred to a sterile culture tube containing 2 mL of Luria-Bertani medium supplemented with 200 µg/mL ampicillin. The culture was grown with shaking at 37°C until the OD₆₀₀ reached ~0.2; then 500 µL of this culture was used to inoculate 2 mL of Luria-Bertani medium containing 400 µg/mL ampicillin. Initial expression tests were performed by adding IPTG (final concentration of 1 mM) to the 2-mL cultures when the OD₆₀₀ reached ~0.5. These cultures were analyzed by denaturing gel electrophoresis for protein expression after ~3 h. For scale-up, the 2-mL culture was grown without addition of IPTG to an OD₆₀₀ ~0.5, and 250 µL was used to inoculate each of four 2-L flasks containing 500 mL of Luria-Bertani medium supplemented with 400 µg/mL ampicillin. The cultures were grown at 37°C until the OD₆₀₀ reached ~0.6. At this point, the growth temperature was reduced to 25°C and the culture was induced by addition of IPTG to a concentration of 1 mM. At induction, the cultures were supplemented with Casamino acids (Difco) to a concentration of 0.5 g/L and with FeSO₄ to a concentration of 80 µM. The induced culture was grown for ~12 h and harvested by centrifugation for 15 min at 4°C and 4400g in a Beckman J-6B centrifuge equipped with a JS-5.2 rotor (Beckman). This procedure gave ~1.5 g/L wet cell paste.

For selenomethionine labeling, the transformation and growth of a 3-mL culture in Luria-Bertani medium were performed as described above for the 2-mL culture. After the 3-mL starter culture reached an OD₆₀₀ of ~0.2, 750 µL was used to inoculate each of four 2-L flasks containing 500 mL of a chemically defined medium (Studts and Fox 1999) and 200 µg/mL ampicillin. Each 500-mL culture was supplemented with 500 µL of a solution of 5 mg/mL thiamine. The cultures were grown with shaking at 37°C for ~8 h, after which the temperature was reduced to 23°C for ~10 h. When the culture reached OD₆₀₀ ~0.4, the temperature was increased to 30°C and the following amino acids were added to the cultures: 100 µg/mL lysine, threonine, and phenylalanine, 100 mg/mL leucine, isoleucine, and valine, and 50 mg/mL selenomethionine. The cultures were induced after 20 min with 1 mM IPTG, and the medium was supplemented with 80 µM of FeSO₄ and 5 g/L glucose. The induced culture was grown for ~6 h at 30°C and harvested as described above. This procedure gave ~1.5 g/L wet cell paste.

Purification of DesA2
All purification steps were performed at 4°C. The cell paste from 2 L of culture medium (~6 g) was thawed in a 50-mL stainless steel beaker and resuspended in 25 mL of 25 mM MOPS, pH 7.0. The cells were incubated on ice for 10 min after the addition of 50 mg each of lysozyme, RNase, and DNase to the cell suspension. The cell mixture was sonicated for a total of 1 min using 10-sec pulses (Fisher Model 550 Sonic Dismembrator, 1/8-inch horn, 45% maximum output). During sonication, the temperature of the cell suspension was maintained below 10°C by placing the beaker in an ice water bath containing NaCl. The sonicated cell suspension was centrifuged for 1 h at 39,000g to remove cell debris. The supernatant was diluted to 100 mL with 25 mM MOPS, pH 7.0 and loaded onto a Fast Flow Q-Sepharose 16/10 (Pharmacia LKB Biotechnology) equilibrated in 25 mM MOPS, pH 7.0. The column was washed with 60 mL of 25 mM MOPS, pH 7.0 and the protein was eluted at 7.6 cm/h in a 0.6-L linear gradient from 0 to 0.5M NaCl in 25 mM MOPS, pH 7.0. Column fractions were analyzed by SDS-PAGE, and peak fractions were pooled and concentrated by ultrafiltration (YM30 membrane, Amicon). The concentrated peak fractions were loaded onto a HiPrep 26/60 Sepharacyl S-100 column (Pharmacia LKB Biotechnology) equilibrated with 25 mM MOPS, pH 7.0, containing 25 mM NaCl and eluted at 6.8 cm/h. Peak fractions were analyzed by SDS-PAGE, pooled, and concentrated by ultrafiltration. After concentration to ~30 mg/mL, the purified DesA2 was drop-frozen in liquid nitrogen and stored at ~80°C.

Protein determinations
The identity of the purified protein was confirmed by mass determinations at the Mass Spectrometry Facility at the University of Wisconsin Biotechnology Center using an Applied Biosystems MDS Sciex API 365 LC/MS/MS triple quadrupole spectrometer equipped with a Perkin Elmer ABI 140D HPLC inlet system and operated in negative ionization mode. The concentration of purified DesA2 was determined by absorbance at 280 nm using ₂₈₀=50,550 M^–1 cm^–1 calculated from the amino acid content using DNASTAR (version 5.52).

Crystallization
Before crystallization trials, DesA2 was dialyzed in a Slide-ALyzer dialysis cassette (Pierce) in 25 mM HEPES, pH 7.0 containing 25 mM NaCl for 20 h at 4°C. Crystals of DesA2 were grown by the method of hanging drop vapor diffusion at room temperature. Typically, 2 µL of DesA2 at 10 mg/mL was combined with an equal volume of 17% methyl ether polyethylene glycol, 10 mM MnCl₂, 20 mM Bis Tris propane, pH 7.0, and 30 mM sodium acetate, pH4.5. For low-temperature data collection, crystals were flash frozen in liquid N₂ using the crystallization mother liquor plus 15% ethylene glycol and an incubation time of 10 sec. The selenomethionine-substituted DesA2 was crystallized in a similar manner.

Structure determination
MAD data were collected at three wavelengths on a single frozen crystal at beamline 32-ID of the Structural Biology Center at the Advanced Photon Source (Argonne, IL). For the peak, remote, and inflection point wavelengths, 180 images were recorded on a Mar Research CCD detector using 0.5° oscillations and 2-sec exposure times at a crystal-to-detector distance of 180 mm and a temperature of –160°C. The diffraction data were processed and scaled using the HKL 2000 software suite (Otwinowski and Minor 1997). The Friedel differences in the reference data set (peak) were locally scaled to remove systematic errors. A high-resolution native data set was collected for refinement of the final model. A preliminary X-ray fluorescence scan revealed the absence of iron in both the native and Se-Met crystals. SOLVE (Terwilliger 2002) was utilized to locate three Se sites in the asymmetric unit and to calculate phases using the 20–2.35 Å MAD data. The Se sites were employed to calculate initial phases, which were improved by the solvent flattening program RESOLVE (Terwilliger 2003). An initial model was built with ARP/wARP (Terwilliger 2003) and improved by manual adjustment with TURBO FRODO (Roussel and Cambillau 1991). After initial rounds of maximum likelihood refinement with the program REFMAC (Murshudov et al. 1997), the native structure was determined by molecular replacement utilizing the program MOLREP (Vagin and Teplyakov 2000) starting from the model obtained from the MAD structural solution. The final structural model was obtained from alternating rounds of model building and maximum likelihood refinement. Coordinates for the crystal structure and structure factors have been deposited in the Protein Data Bank with accession number 1ZA0.

	Acknowledgments

 
The National Institutes of Health supported this work (GM-50853 to B.G.F. and AR-35186 to I.R). K.S.L. was a trainee of the NIH Institutional Molecular Biophysics Pre-Doctoral Training Grant T32 GM-08293. We thank the Mycobacterium Structural Genomics Consortium for their useful public Web site (http://www.doe-mbi.ucla.edu/TB/), Dr. Patrick J. Brennan (Colorado State University) for enlightening discussions, and Dr. Mary Jackson (Institute Pasteur) for the contribution of various proteins and enzymes to mycolic acid biosynthesis and viability of mycobacteria.

	References

TOP Abstract Introduction Results Discussion Materials and methods References

 
The Arabidopsis Genome Initiative. 2000. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815.[CrossRef][Medline]

Baldwin, J., Voegtli, W.C., Khidekel, N., Moénne-Loccoz, P., Krebs, C., Pereira, A.S., Ley, B.A., Huynh, B.H., Loehr, T.M., Riggs-Gelasco, P.J., et al. 2001. Rational reprogramming of the R2 subunit of Escherichia coli ribonucleotide reductase into a self-hydroxylating monooxygenase. J. Am. Chem. Soc. 123: 7017–7030.[Medline]

Barry 3rd, C.E., Lee, R.E., Mdluli, K., Sampson, A.E., Schroeder, B.G., and Slayden, R.A. 1998. Mycolic acids: Structure, biosynthesis, and physiological functions. Prog. Lipid Res. 37: 143–179.[CrossRef][Medline]

Bloch, K. 1969. Enzymatic synthesis of monounsaturated fatty acids. Acc. Chem. Res. 2: 193–202.

Bollinger, Jr., J.M., Krebs, C., Vicol, A., Chen, S., Ley, B.A., Edmondson, D.E., and Huynh, B.H. 1998. Engineering the diiron site of Escherichia coli ribonucleotide reductase protein R2 to accumulate an intermediate similar to Hperoxo, the putative peroxodiiron(III) complex from the methane monooxygenase catalytic cycle. J. Am. Chem. Soc. 120: 1094–1095.[CrossRef]

Broadwater, J.A., Ai, J., Loehr, T.M., Sanders-Loehr, J., and Fox, B.G. 1998. Peroxodiferric intermediate of stearoyl-acyl carrier protein ⁹ desaturase: Oxidase reactivity during single turnover and implications for the mechanism of desaturation. Biochemistry 37: 14664–14671.[CrossRef][Medline]

Cohen, G.H. 1997. ALIGN: A program to superimpose protein coordinates, accounting for insertions and deletions. J. App. Cryst. 30: 1160–1161.[CrossRef]

Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S.V., Eiglmeier, K., Gas, S., Barry 3rd, C.E., et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537–544.[CrossRef][Medline]

Crump, M.P., Crosby, J., Dempsey, C.E., Parkinson, J.A., Murray, M., Hopwood, D.A., and Simpson, T.J. 1997. Solution structure of the actinorhodin polyketide synthase acyl carrier protein from Streptomyces coelicolor A3(2). Biochemistry 36: 6000–6008.[CrossRef][Medline]

DeLano, W.L. 2003. MacPyMOL, 0.95 ed. DeLano Scientific LLC, San Carlos, CA.

Doublie, S. 1997. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 276: 523–530.[Medline]

Dubnau, E., Chan, J., Raynaud, C., Mohan, V.P., Laneelle, M.A., Yu, K., Quemard, A., Smith, I., and Daffe, M. 2000. Oxygenated mycolic acids are necessary for virulence of Mycobacterium tuberculosis in mice. Mol. Microbiol. 36: 630–637.[CrossRef][Medline]

Elango, N., Radhakrishnan, R., Froland, W.A., Wallar, B.J., Earhart, C.A., Lipscomb, J.D., and Ohlendorf, D.H. 1997. Crystal structure of the hydroxylase component of methane monooxygenase from Methylosinus trichosporium OB3b. Protein Sci. 6: 556–568.[Abstract]

Fox, B.G., Shanklin, J., Somerville, C., and Münck, E. 1993. Stearoyl acyl carrier protein ⁹ desaturase from Ricinus communis is a diiron-oxo protein. Proc. Natl. Acad. Sci. 90: 2486–2490.[Abstract/Free Full Text]

Fox, B.G., Shanklin, J., Ai, J., Loehr, T.M., and Sanders-Loehr, J. 1994. Resonance Raman evidence for an Fe-O-Fe center in stearoyl-ACP desaturase. Primary sequence identity with other diiron-oxo proteins. Biochemistry 33: 12776–12786.[CrossRef][Medline]

Fox, B.G., Lyle, K.S., and Rogge, C.E. 2004. Reactions of the diiron enzyme stearoyl-ACP desaturase. Acc. Chem. Res. 37: 421–429.[CrossRef][Medline]

Haas, J.A. and Fox, B.G. 1999. The role of hydrophobic partitioning in substrate selectivity and turnover of the Ricinus communis stearoyl-ACP ⁹ desaturase. Biochemistry 38: 12833–12840.[CrossRef][Medline]

Hoffman, B.J., Broadwater, J.A., Johnson, P., Harper, J., Fox, B.G., and Kenealy, W.R. 1995. Lactose fed-batch overexpression of recombinant metalloproteins in Escherichia coli BL21(DE3): Process control yielding high levels of metal incorporated, soluble protein. Protein Expression Purif. 6: 646–654.[CrossRef][Medline]

Holak, T.A., Kearsley, S.K., Kim, Y., and Prestegard, J.H. 1988. Three dimensional structure of acyl carrier protein determined by NMR pseudoenergy and distance geometry calculations. Biochemistry 27: 6135–6142.[CrossRef][Medline]

Kim, Y. and Prestegard, J.H. 1989. A dynamic model for the structure of acyl carrier protein in solution. Biochemistry 28: 8792–8797.[CrossRef][Medline]

Li, Q., Khosla, C., Puglisi, J.D., and Liu, C.W. 2003. Solution structure and backbone dynamics of the holo form of the frenolicin acyl carrier protein. Biochemistry 42: 4648–4657.[CrossRef][Medline]

Lindqvist, Y., Huang, W., Schneider, G., and Shanklin, J. 1996. Crystal structure of ⁹ stearoyl-acyl carrier protein desaturase from castor seed and its relationship to other diiron proteins. EMBO J. 15: 4081–4092.[Medline]

Lyle, K.S., Haas, J.A., and Fox, B.G. 2003. Rapid-mix and chemical quench studies of ferredoxin-reduced stearoyl-acyl carrier protein desaturase. Biochemistry 42: 5857–5866.[Medline]

Mitchell, K.H., Studts, J.M., and Fox, B.G. 2002. Combined participation of effector protein binding and hydroxylase active site residues provide toluene 4-monooxygenase regiospecificity. Biochemistry 41: 3176–3188.[CrossRef][Medline]

Moche, M., Shanklin, J., Ghoshal, A., and Lindqvist, Y. 2003. Azide and acetate complexes plus two iron-depleted crystal structures of the diiron enzyme 9 stearoyl-acyl carrier protein desaturase. J. Biol. Chem. 278: 25072–25080.[Abstract/Free Full Text]

Murshudov, G.N., Vagin, A.A., and Dodson, E.J. 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53: 240–255.[CrossRef][Medline]

Nordlund, P. and Eklund, H. 1993. Structure and function of the Escherichia coli ribonucleotide reductase protein R2. J. Mol. Biol. 232: 123–164.[CrossRef][Medline]

Ntambi, J.M. 1995. The regulation of stearoyl-CoA desaturase (SCD). Prog. Lipid Res. 34: 139–150.[CrossRef][Medline]

Ntambi, J.M., Miyazaki, M., Stoehr, J.P., Lan, H., Kendziorski, C.M., Yandell, B.S., Song, Y., Cohen, P., Friedman, J.M., and Attie, A.D. 2002. Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity. Proc. Natl. Acad. Sci. 99: 11482–11486.[Abstract/Free Full Text]

Otwinowski, Z. and Minor, W. 1997. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276: 307–326.

Phetsuksiri, B., Jackson,M., Scherman, H.,McNeil, M., Besra, G.S., Baulard, A.R., Slayden, R.A., DeBarber, A.E., Barry 3rd, C.E., Baird, M.S., et al. 2003. Unique mechanism of action of the thiourea drug isoxyl on Mycobacterium tuberculosis. J. Biol. Chem. 278: 53123–53130.[Abstract/Free Full Text]

A.C., Frederick, C.A., Lippard, S.J., and Nordlund, P. 1993. Crystal structure of a bacterial non-haem iron hydroxylase that catalyses the biological oxidation of methane. Nature 336: 537–543.

Roussel, A. and Cambillau, C. 1991. Silicon graphics geometry partners directory. Silicon Graphics, Mountain View, CA.

Sahlin, M., Lassmann, G., Pötsch, S., Slaby, A., Sjöberg, B.-M., and Gräslund, A. 1994. Tryptophan radicals formed by iron/oxygen reaction with Escherichia coli ribonucleotide reductase protein R2 mutant Y122F. J. Biol. Chem. 269: 11699–11702.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F., and Maniatis, T. 2001. Molecular cloning: A laboratory manual, 3d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sazinsky, M.H., Bard, J., Di Donato, A., and Lippard, S.J. 2004. Crystal structure of the toluene/o-xylene monooxygenase hydroxylase from Pseudomonas stutzeri OX1. J. Biol. Chem. 279: 30600–30610.[Abstract/Free Full Text]

Shanklin, J. and Somerville, C. 1991. Stearoyl-acyl-carrier-protein desaturase from higher plants is structurally unrelated to the animal and fungal homologs. Proc. Natl. Acad. Sci. 88: 2510–2514.[Abstract/Free Full Text]

Studts, J.M. and Fox, B.G. 1999. Application of fed-batch fermentation to the preparation of isotopically labeled- or selenomethionine-labeled proteins. Protein Expression Purif. 16: 109–119.[Medline]

Takagi, H., Shi, D., Ha, Y., Allewell, N.M., and Theil, E.C. 1998. Localized unfolding at the junction of three ferritin subunits. A mechanism for iron release? J. Biol. Chem. 273: 18685–18688.[Abstract/Free Full Text]

Terwilliger, T.C. 2002. Automated structure solution, density modification and model building. Acta Crystallogr. D Biol. Crystallogr. 58: 1937–1940.[CrossRef][Medline]

———. 2003. SOLVE and RESOLVE: Automated structure solution and density modification. Methods Enzymol. 374: 22–37.[Medline]

Thompson, J.D., Higgins, D.G., and Gibson, T.J. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673–4680.[Abstract/Free Full Text]

Vagin, A. and Teplyakov, A. 2000. An approach to multi-copy search in molecular replacement. Acta Crystallogr. D Biol. Crystallogr. 56: 1622–1624.[CrossRef][Medline]

Watanabe, M., Aoyagi, Y., Mitome, H., Fujita, T., Naoka, H., Ridell, M., and Minnikin, D.E. 2002. Location of functional groups in mycobacterial meromycolate chains; the recognition of new structural principles in mycolic acids. Microbiology 148: 1881–1902.[Abstract/Free Full Text]

Wong, H.C., Liu, G., Zhang, Y.-M., Rock, C.O., and Zheng, J. 2002. The solution structure of acyl carrier protein from Mycobacterium tuberculosis. J. Biol. Chem. 277: 15874–15880.[Abstract/Free Full Text]

Xu, G.Y., Tam, A., Lin, L., Hixon, J., Fritz, C.C., and Powers, R. 2001. Solution structure of B. subtilis acyl carrier protein. Structure 9: 277–287.[Medline]

Yuan, Y., Lee, R.E., Besra, G.S., Belisle, J.T., and Barry 3rd, C.E. 1995. Identification of a gene involved in the biosynthesis of cyclopropanated mycolic acids in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. 92: 6630–6634.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				J. E. Guy, E. Whittle, D. Kumaran, Y. Lindqvist, and J. Shanklin The Crystal Structure of the Ivy {Delta}4-16:0-ACP Desaturase Reveals Structural Details of the Oxidized Active Site and Potential Determinants of Regioselectivity J. Biol. Chem., July 6, 2007; 282(27): 19863 - 19871. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dyer, D. H. Articles by Fox, B. G. Search for Related Content PubMed PubMed Citation Articles by Dyer, D. H. Articles by Fox, B. G. Social Bookmarking                   What's this?