HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: ps.062216006v1 15/7/1619    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liang, J. J. Articles by Liu, B.-F. Search for Related Content PubMed PubMed Citation Articles by Liang, J. J. Articles by Liu, B.-F. Social Bookmarking                   What's this?

Fluorescence resonance energy transfer study of subunit exchange in human lens crystallins and congenital cataract crystallin mutants

Ophthalmic Research/Surgery, Brigham and Women's Hospital, Boston, Massachusetts 02115, USA
Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts 02115, USA

(RECEIVED March 14, 2006; FINAL REVISION April 3, 2006; ACCEPTED April 3, 2006)

	Abstract

TOP Abstract Introduction Results Discussion Materials and methods References

 
Lens -crystallin is an oligomeric protein with a molecular mass of 500–1000 kDa and a polydispersed assembly. It consists of two types of subunits, A and B, each with a molecular mass of 20 kDa. The subunits also form homo-oligomers in some other tissues and in vitro. Their quaternary structures, which are dynamic and characterized by subunit exchange, have been studied by many techniques, including fluorescence resonance energy transfer (FRET) and mass spectrometry analysis. The proposed mechanism of subunit exchange has been either by dissociation/association of monomeric subunits or by rapid equilibrium between oligomers and suboligomers. To explore the nature of subunit exchange further, we performed additional FRET measurements and analyses using a fluorescent dye-labeled W9F A-crystallin as the acceptor probe and Trp in other crystallins (wild-type and R116C A, wild-type and R120G B, wild-type and Q155* B2) as the donor probe and calculated the transfer efficiency, Förster distance, and average distance between two probes. The results indicate only slight decreased efficiency and increased distance between two probes for the R116C A and R120G B mutations despite conformational changes.

Keywords: crystallin; FRET; subunit exchange; protein–protein interaction; fluorescence; congenital cataract crystallin mutants

	Introduction

TOP Abstract Introduction Results Discussion Materials and methods References

 
Human lens crystallins consist of three major classes: -, -, and -crystallin. -Crystallin is expressed in both epithelial and fiber cells, whereas - and -crystallin are expressed only in the fiber cells. These crystallins function both as structural proteins and as refractive index gradients and are believed to interact to maintain lens transparency. -Crystallin consists of two 20-kDa subunits, A and B, forming either a hetero- or a homopolymer with a molecular mass of 500–1000 kDa. The ratio of A to B is 3:1 in mature human lenses and may vary in other mammalian species. The three-dimensional structures of the hetero- and homopolymers are not known. The reported quaternary structure is a sphere with a cavity (Haley et al. 1998), with a dynamic structure exhibiting subunit exchange first shown by van den Oetelaar et al. (1990). -Crystallin was found to have additional chaperone-like activity protecting other proteins from denaturation and aggregation (Horwitz 1992).

The subunit exchange has been observed by various methods, including isoelectric focusing (van den Oetelaar et al. 1990; Sun and Liang 1998), fluorescence resonance energy transfer (FRET) (Bova et al. 1997, 2000; Sun et al. 1998; Cobb and Petrash 2000), and mass spectrometry analysis (Sobott et al. 2002; Aquilina et al. 2005). FRET measurements require two probes, a donor in the first protein and an acceptor in the second protein. The energy transfer occurs when the two proteins interact and the two probes are sufficiently close to one another as defined by Förster distance (Lakowicz 1983). One earlier study indicated that FRET occurred between -crystallins but not between - and - or -crystallin, and this was interpreted as the result of subunit exchange in -crystallins (Bova et al. 1997). Subsequent studies indicated that the FRET decreases with protein modifications or mutations (Cobb and Petrash 2000; Bera and Abraham 2002; Liang and Fu 2002), possibly because of conformational changes that retard the subunit exchange. The mechanism of subunit exchange suggested earlier involved dissociation and association of monomeric subunits (Vanhoudt et al. 1998, 2000; Bova et al. 2000). Recently, mass spectrometry analysis suggested that small heat shock protein complexes are in rapid dissociation/association equilibria with suboligomers and that the rate of dissociation of oligomers dictates the dynamics of subunit exchange (Sobott et al. 2002; Aquilina et al. 2005). Mass spectrometry analysis study has some advantages in that it does not require labeling and provides real-time analysis of the transient species and the relative populations during subunit exchange. However, it does not yield some information, such as the distance of probes in multimeric assembly. We have used two-hybrid system assays to screen protein–protein interactions among crystallins and observed strong interactions between -crystallins (A–A, B–B, and A–B), especially between A- and B-crystallins (Fu and Liang 2002b, 2003). However, our understanding of the mechanism of the interactions revealed by the two-hybrid system is not complete; we still do not know whether the fused A- or B-crystallin can undergo subunit exchange.

To understand the subunit exchange further, we have determined some FRET parameters, such as transfer efficiency, Förster distance, and distance between two probes, using W9F A-crystallin labeled with IAEDANS (5-((((2-iodoacetyl)amino)ethyl)amino) naphthalene-1-sulfonic acid) as the acceptor probe and Trp in other crystallins as the donor probe. We have chosen A-, B-, and B2-crystallin and their corresponding congenital cataract mutants R116C A, R120G B, and Q155* B2 as models. The results confirmed the presence of exchange between A- and B-crystallin but not between A- and B2-crystallin. The results also indicated a slight decrease in the exchange efficiency of the mutant crystallins and some difference in FRET parameters between A-crystallin and the R116C mutant and practically no difference between B-crystallin and the R120G mutant.

	Results

TOP Abstract Introduction Results Discussion Materials and methods References

 
Recombinant R116C A- and R120G B-crystallin
The preparations of R116C A- and R120G B-crystallin were checked for purity with SDS-PAGE (Fig. 1) and for molecular size with FPLC size-exclusion chromatography (Fig. 2). The molecular size appeared to increase slightly in R116C A-crystallin and appreciably in R120G B-crystallin relative to the wild-type protein.

View larger version (62K): [in this window] [in a new window]   Figure 1. SDS-PAGE of R116C A- and R120G B-crystallin. (Lanes 1,4) Markers, (lanes 2,5) R116C A- and R120G B-crystallin, (lanes 3,6) wild-type A- and B-crystallin.

View larger version (18K): [in this window] [in a new window]   Figure 2. FPLC size exclusion chromatography of R116C A- (top) and R120G B-crystallin (bottom) on Superose 6 column: protein concentrations at 0.5–1.0 mg/mL and flow rate at 0.5 mL/min. The markers indicated in the upper X-axis are from the profile of calf lens soluble proteins (-, H-, L-, and -crystallin).

View larger version (19K): [in this window] [in a new window]   Figure 3. Trp fluorescence of R11C A- (top) and R120G B-crystallin (bottom): excitation wavelength at 295 nm and protein concentration at 0.1 mg/mL in 50 mM phosphate buffer (pH 7.6).

View larger version (20K): [in this window] [in a new window]   Figure 4. Bis-ANS fluorescence of R11C A- (top) and R120G B-crystallin (bottom): excitation at 336 nm, protein concentration at 0.1 mg/mL, and Bis-ANS at 5 x 10–5 M in 50 mM phosphate buffer (pH 7.6).

View larger version (21K): [in this window] [in a new window]   Figure 5. Far-UV (A) and near-UV (B) CD spectra of R11C A- and R120G B-crystallin: protein concentration at 0.2–0.5 mg/mL in 50 mM phosphate buffer (pH 7.6), and cell path-length of 1 mm for far-UV region and 10 mm for near-UV region.

View larger version (23K): [in this window] [in a new window]   Figure 6. Absorption and fluorescence spectra of B-crystallin and IAEDANS-labeled W9F A-crystallin: (•) Trp fluorescence (ex = 295 nm); () Trp absorption; () IAEDANS fluorescence (ex = 336 nm); () IAEDANS absorption.

View larger version (22K): [in this window] [in a new window]   Figure 7. Time-dependent emission spectra (em = 295 nm) of the FRET system of IAEDANS-AW9F with crystallin donors: (A) B wild-type, (B) B wild-type + AW9F, (C) AW9F. The sample solutions were kept at 37°C, and measurements were made each hour from 0 to 5 h (curves 1–6).

View larger version (31K): [in this window] [in a new window]   Figure 8. Time-dependent emission spectra (em = 295 nm) of the FRET system of IAEDANS-AW9F with crystallin donors: wild-type and R116C A-crystallin, wild-type and R120G B-crystallin, and wild-type and Q155* B2-crystallin. The sample solutions of equal amounts of donor and acceptor proteins (0.1 mg/mL) were kept at either 37°C (A) or 45°C (B), and measurements were made each hour from 0 to 5 h (curves 1–6).

View this table: [in this window] [in a new window]   Table 1. FRET parameters between IAEDANS-labeled W9F A-crystallin (acceptor) and wild-type A-crystallins (donors)

	Discussion

TOP Abstract Introduction Results Discussion Materials and methods References

The observation of greater transfer efficiency for A–B than for A–A indicates that energy transfer between A–B is more favorable than that between A–A, which may be related to the greater stability of the A–B hetero-oligomer than of either A or B alone (Sun and Liang 1998; Horwitz et al. 1999). The structure of A–B hetero-oligomers is more compact than that of A homo-oligomers; the distance between two probes is shorter in the A–B hetero-oligomer than in A homo-oligomers. The observation of this short distance agrees with the recent report of a chemical cross-linking study; the distance between Lys-166 in A-crystallin and Lys-175 in B-crystallin was found to be within 12 Å in the native assembly (Swaim et al. 2004). This short distance reflects the close proximity of the flexible C termini. Our finding of a distance of 18 Å between Cys-131 or Cys-141 in the central domain of A-crystallin and Trp-9 or Trp-60 in the N terminus of B-crystallin is logical. Thus, our analyses of transfer efficiency, Förster distance, and the average distance between two probes provide a clearer picture of subunit exchange than do the previous FRET studies.

The effects of congenital cataract mutations on the protein–protein interactions have also been studied by both FRET (Cobb and Petrash 2000) and the two-hybrid system (Fu and Liang 2003). Conformational changes are believed to contribute to the decreased protein–protein interactions. Our spectroscopic data, as well as those of others (Horwitz et al. 1999; Kumar et al. 1999; Perng et al. 1999; Cobb and Petrash 2000; Bera and Abraham 2002), indicate that the R116C mutation of A- and the R120G mutation of B-crystallin have caused conformational changes and partial unfolding of the proteins, which then affects subunit exchange. Both partial unfolding and decreased subunit exchange lead to decreased protein stability; subunit exchange enables -crystallin to respond to or offset the destabilizing changes under various stresses. -Crystallin was found in the high-molecular-weight aggregated state either in aging lenses or after heat treatment, and decreased subunit exchange was observed, which might have accelerated the deterioration in the structure and function of -crystallin (Liang and Akhtar 2000; Liang and Fu 2002). On the other hand, a smaller A_1–168 truncated protein aggregate also showed a significant decrease in the rate of exchange with B-crystallin as compared with the wild-type A-crystallin in a recent mass spectrometry analysis (Aquilina et al. 2005), indicating that either an increased or a decreased aggregate size could contribute to the decreased exchange.

It is somewhat surprising that the partially unfolded Q155* B2-crystallin did not show FRET with A-crystallin, since -crystallin is supposed to interact with the partially unfolded proteins (Horwitz 1992). Apparently, the partially unfolded proteins that are induced by mutation may not be good substrates for the A-crystallin chaperone in vitro. The same was reported for the T5P C-crystallin mutant (Liang 2004). It needs to be noted that, upon heating, both wild-type and mutant B2- and C-crystallins bind to A-crystallin. A recent study also showed that the I4F D-crystallin mutant did not bind to -crystallin at 37°C but did bind at higher temperature (45°C) to form large aggregates (Liu et al. 2005). It is not clear why the two-hybrid system study shows a weak association between A- and B2- or C-crystallin (Fu and Liang 2002b), but FRET cannot detect any interaction. Perhaps the former detection is performed under physiological conditions and is more sensitive.

The mechanism of subunit exchange suggested earlier involves dissociation and association of monomeric subunits (Vanhoudt et al. 1998, 2000; Bova et al. 2000), advocating the presence of a dynamic structure of -crystallin in which monomer subunits can be removed or added. However, no monomer subunits were observed in physiological solutions because the process is far faster than the time scale of conventional detection methods. A mass spectrometry study has proposed that small heat shock protein complexes are in rapid dissociation/association equilibria with suboligomeric forms (Sobott et al. 2002) and that subunit exchange involves the C-terminal extensions (Aquilina et al. 2005). Subunit exchange may occur through participation in equilibria in which suboligomeric subunits can move out from one oligomeric assembly and move into a different oligomeric assembly. Any factors that change the equilibrium will thus affect subunit exchange. The subunit exchange in R116C and R120G mutants did not change much because the mutations did not remove the C-terminal extensions, but the conformational change is believed to alter the equilibrium that slightly reduced subunit exchange.

The observed FRET between A- and A- or B-, but not between A- and B2- or C-crystallin, may also indicate that the subunit exchange involves the "-crystallin" domain (Caspers et al. 1995); this domain is the primary site for dimerization in -crystallin (Sreelakshmi et al. 2004; Ghosh and Clark 2005). The dimers are the building blocks for the various oligomers/suboligomers participating in exchange. B2- and C-crystallin do not have such a domain and are thus unable to participate in equilibrium and subunit exchange with A-crystallin.

In conclusion, we have demonstrated subunit exchange between -crystallins through observations of energy transfer; subunit exchange likely involves participation in equilibrium of oligomer/suboligomer assemblies. We also showed that mutations in autosomal dominant congenital cataracts slightly decrease transfer efficiencies as a result of conformational change.

	Materials and methods

TOP Abstract Introduction Results Discussion Materials and methods References

 
Cloning of lens crystallins
The recombinant crystallins wild-type A-, B-, and B2-crystallin, and the W9F A- and Q155* B2-crystallin mutants were prepared as described previously (Sun et al. 1997, 1998; Fu and Liang 2002a, 2003; Liu and Liang 2005). R116C A- and R120G B-crystallin mutants were cloned using a QuikChange Mutagenesis kit (Stratagene) as described elsewhere (Sun et al. 1998). The PCR was performed with pAED4-A or pAED4-B plasmids (Sun et al. 1997). Two primers, the forward (TTCCCGTGAGTTCCACTGCCGCTACCGCCTGCC for R116C A and CTCCAGGGAGTTCCACGGGAAATACCGGATCCC for R120G B) and the reverse (GGCAGGCGGTAGCGGCAGTGGAACTCACGGGAA for R116C A and GGGATCCGGTATTTCCCGTGGAACTCCCTGGAG for R120G B), were custom-synthesized by Invitrogen. Protein expression and purifications were carried out as previously reported (Sun et al. 1997).

Purity of expressed proteins was checked with an SDS-PAGE slab gel (15% acrylamide) under reducing conditions according to the method of Laemmli (1970). Molecular size was determined by FPLC size exclusion chromatography on a Superose 6 column.

Purified proteins were dialyzed against 50 mM phosphate buffer (pH 7.6), and were used in the following spectroscopic measurements. Protein concentrations were determined by reading at 280 nm with the following absorbance: A^0.1% = 0.724 for wild-type and 0.422 for W9F A-crystallin; 0.696 for wild-type and R120G B-crystallin; and 1.74 for wild-type and 1.70 for Q155* B2-C-crystallin, calculated using the average values of the protein resident extinction coefficients of tryptophan and tyrosine residues extracted from a large experimental data set (Mach et al. 1992).

Fluorescence and CD
Fluorescence was measured with a Shimadzu spectrofluorometer (model RF-5301PC, Shimadzu Instruments). Trp emission was scanned with an excitation wavelength of 295 nm. Bis-ANS fluorescence emission spectra were scanned between 460 and 560 nm with an excitation wavelength of 395 nm.

CD spectra were obtained with an Aviv Circular Dichroism Spectrometer (model 60 DS, Aviv Associates). Five scans were recorded and averaged and followed by a polynomial-fitting program. The CD was expressed with a unit of deg-cm²-dmol^–1.

FRET
For the determination of quantum yield (Q) and coupling integral (J), the fluorescence spectra were corrected for the wavelength-dependent instrument response using rhodamine B as a reference (Lakowicz 1983; Wu and Brand 1994). In brief, emission or excitation spectrum correction function I(_em) or I(_ex) was measured first for rhodamine B. The uncorrected emission or excitation spectrum of the sample was measured and divided by I(_em) or I(_ex) to give the corrected emission or excitation spectrum F(_em) or F(_ex).

In the present FRET study, W9F A-crystallin was labeled with IAEDANS (_abs = 336 nm, _em = 490 nm, = 5700 M^–1 cm^–1) (Molecular Probes) as an acceptor and Trp in other crystallins as a donor (_abs = 280–290 nm, _em = 330–340 nm). IAEDANS is a sulfhydryl (SH)-specific fluorescent probe and has been used in studies of crystallin (Andley and Clark 1988; Putilina et al. 2003). The labeling protocols from the manufacturer were used. The degree of labeling was estimated to be 0.5 mol of IAEDANS/mol of protein subunit, using the formula: A/ x M/c, where A = absorbance of dye at 336 nm, = molar extinction coefficient of the dye, M = molecular weight of protein, and c = protein concentration. A-crystallin has one Trp, which was substituted with Phe in the W9F mutant; mutation did not change the protein conformation (Andley et al. 1996; Sun et al. 1998). The emission spectrum of Trp (320–350 nm) overlaps the absorption spectrum of IAEDNS (Fig. 6). Energy transfer produces a decrease in Trp fluorescence with a concomitant increase in IAEDANS fluorescence (see Fig. 7).

In FRET experiments, either the emission or the excitation spectrum can be measured to assess energy transfer. In an emission spectrum, the excitation is set at the wavelength of Trp donor absorption (_ex = 295 nm), and any increase in emission intensity of the acceptor is measured. In an excitation spectrum, the detection is set at IAEDANS acceptor emission wavelength (_em = 490 nm), and enhancement of intensity at the wavelength of donor excitation is measured. In the present FRET study, we measured emission spectra. The three samples, crystallin donors (unlabeled crystallins) in the presence and the absence of acceptor (labeled W9F A-crystallin) and labeled W9F A-crystallin alone, were scanned (at 295-nm excitation wavelength) every hour at either 37° or 45°C. The Trp emission intensities decreased and the IAEDANS emission intensities increased with time. After 4–5 h (at 37°C) or within 30 min (at 45°C), the emission intensities stopped changing or energy transfer ceased. The fluorescence intensities of (crystallin donors + I-AW9F) were subtracted from those of I-AW9F alone because I-AW9F also showed some fluorescence at 450–500 nm.

The FRET efficiency is related to the inverse sixth power of distance between the probes (R) as defined by the Förster equation (Lakowicz 1983; Steer and Merrill 1994; Wu and Brand 1994):

where R_o is the Förster distance at which the transfer efficiency is 50%. The efficiency of transfer (E) can be calculated from the equation:

where F_DA and F_D are the donor fluorescence intensities in the presence and the absence of energy transfer.

The Förster distance (R_o) at which the transfer efficiency is 50% can be calculated by the equation:

where ² is the orientation factor that describes the rotational movement of the donor and acceptor probes relative to each other and is generally assumed to be equal to 2/3; _D is the quantum yield of donor in the absence of acceptor; n is refractive index taken as 1.4; and J is the spectral overlap integral representing the degree of overlap between the donor fluorescence spectrum and the acceptor absorption spectrum:

where F_D is the corrected fluorescence spectrum of the donor in the wavelength range to + with the total intensity (area under the curve) normalized unity, and _A is the molar absorption coefficient (unit M^–1cm^–1) of the acceptor at (nm). J can be calculated by numerical summation from the corrected fluorescence spectrum of the donor and the absorption spectrum of the acceptor as described by the equation:

with a unit M^–1cm^–1 nm⁴. A computer program has been designed for calculating the J values.

The quantum yield for the donor Trp is estimated by the formula (Kronman et al. 1971; Liang and Chakrabarti 1982):

where A is the area under emission spectrum, is quantum yield, and O is optical density at excitation wavelength. The subscript D is for samples, and the subscript R is for reference free Trp. The _R value of 0.20 for free Trp is used (Kronman et al. 1971).

From obtained values of E and R_o, the average distance (R) between donor and acceptor was calculated by Equation 1.

	Footnotes

 
Reprint requests to: Jack J. Liang, Ophthalmic Research, Brigham and Women's Hospital, 221 Longwood Avenue, Boston, MA 02115, USA; e-mail: jliang{at}rics.bwh.harvard.edu; fax: (617) 278-0556.

Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.062216006.

Abbreviations: Bis-ANS, 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid; CD, circular dichroism; FRET, fluorescence resonance energy transfer; HMW, high-molecular-weight; IAEDANS, 5-((((2-iodoacetyl)amino)ethyl)amino) naphthalene-1-sulfonic acid.

	Acknowledgments

 
This work was supported by a grant from the NIH (EY13968) and the Massachusetts Lions Eye Research Fund. Technical help from Michael Liang is acknowledged.

	References

TOP Abstract Introduction Results Discussion Materials and methods References

 
Andley U.P. and Clark B.A. 1988. Accessibilities of the sulfhydryl groups of native and photooxidized lens crystallins: A fluorescence lifetime and quenching study. Biochemistry 27: 810–820.[Medline]

Andley U.P., Mathur S., Griest T.A., Petrash J.M. 1996. Cloning, expression, and chaperone-like activity of human A-crystallin. J. Biol. Chem. 271: 31973–31980.[Abstract/Free Full Text]

Aquilina J.A., Benesch J.L., Ding L.L., Yaron O., Horwitz J., Robinson C.V. 2005. Subunit exchange of polydisperse proteins: Mass spectrometry reveals consequences of A-crystallin truncation. J. Biol. Chem. 280: 14485–14491.[Abstract/Free Full Text]

Bera S. and Abraham E.C. 2002. The A-crystallin R116C mutant has a higher affinity for forming heteroaggregates with B-crystallin. Biochemistry 41: 297–305.[CrossRef][Medline]

Boelens W.C., Croes Y., de Ruwe M., de Reu L., de Jong W.W. 1998. Negative charges in the C-terminal domain stabilize the B-crystallin complex. J. Biol. Chem. 273: 28085–28090.[Abstract/Free Full Text]

Bova M.P., Ding L.L., Horwitz J., Fung B.K. 1997. Subunit exchange of A-crystallin. J. Biol. Chem. 272: 29511–29517.[Abstract/Free Full Text]

Bova M.P., Mchaourab H.S., Han Y., Fung B.K. 2000. Subunit exchange of small heat shock proteins. Analysis of oligomer formation of A-crystallin and Hsp27 by fluorescence resonance energy transfer and site-directed truncations. J. Biol. Chem. 275: 1035–1042.[Abstract/Free Full Text]

Caspers G.J., Leunissen J.A., de Jong W.W. 1995. The expanding small heat-shock protein family, and structure predictions of the conserved "-crystallin domain". J. Mol. Evol. 40: 238–248.[CrossRef][Medline]

Cobb B.A. and Petrash J.M. 2000. Structural and functional changes in the  A-crystallin R116C mutant in hereditary cataracts. Biochemistry 39: 15791–15798.[CrossRef][Medline]

Fu L. and Liang J.J. 2002a. Conformational change and destabilization of cataract C-crystallin T5P mutant. FEBS Lett. 513: 213–216.[CrossRef][Medline]

Fu L. and Liang J.J. 2002b. Detection of protein–protein interactions among lens crystallins in a mammalian two-hybrid system assay. J. Biol. Chem. 277: 4255–4260.[Abstract/Free Full Text]

Fu L. and Liang J.J. 2003. Alteration of protein–protein interactions of congenital cataract crystallin mutants. Invest. Ophthalmol. Vis. Sci. 44: 1155–1159.[Abstract/Free Full Text]

Ghosh J.G. and Clark J.I. 2005. Insights into the domains required for dimerization and assembly of human B crystallin. Protein Sci. 14: 684–695.[Abstract/Free Full Text]

Haley D.A., Horwitz J., Stewart P.L. 1998. The small heat-shock protein, B-crystallin, has a variable quaternary structure. J. Mol. Biol. 277: 27–35.[CrossRef][Medline]

Horwitz J. 1992. -crystallin can function as a molecular chaperone. Proc. Natl. Acad. Sci. 89: 10449–10453.[Abstract/Free Full Text]

Horwitz J., Bova M.P., Ding L.L., Haley D.A., Stewart P.L. 1999. Lens -crystallin: Function and structure. Eye 13: 403–408.

Kronman M.J., Holmes L.G., Robbins F.M. 1971. Inter- and intramolecular interactions of -lactalbumin. X. Effect of acylation of tyrosyl and lysyl side chains on molecular conformations. J. Biol. Chem. 246: 1909–1921.[Abstract/Free Full Text]

Kumar L.V., Ramakrishna T., Rao C.M. 1999. Structural and functional consequences of the mutation of a conserved arginine residue in A and B crystallins. J. Biol. Chem. 274: 24137–24141.[Abstract/Free Full Text]

Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685.[CrossRef][Medline]

Lakowicz J. In Principles of fluorescence spectroscopy . 1983. Plenum Press, New York.

Le Doan T., Takasugi M., Aragon I., Boudet G., Montenay-Garestier T., Helene C. 1983. Excitation energy transfer from tryptophan residues of peptides and intrinsic proteins to diphenylhexatriene in phospholipid vesicles and biological membranes. Biochim. Biophys. Acta 735: 259–270.[Medline]

Liang J.J. 2004. Interactions and chaperone function of A-crystallin with T5P C-crystallin mutant. Protein Sci. 13: 2476–2482.[Abstract/Free Full Text]

Liang J.J. and Akhtar N.J. 2000. Human lens high-molecular-weight -crystallin aggregates. Biochem. Biophys. Res. Commun. 275: 354–359.[CrossRef][Medline]

Liang J.N. and Chakrabarti B. 1982. Spectroscopic investigations of bovine lens crystallins. 1. Circular dichroism and intrinsic fluorescence. Biochemistry 21: 1847–1852.[CrossRef][Medline]

Liang J.J. and Fu L. 2002. Decreased subunit exchange of heat-treated lens  A-crystallin. Biochem. Biophys. Res. Commun. 293: 7–12.[Medline]

Liang J.N., Andley U.P., Chylack Jr. L.T. 1985. Spectroscopic studies on human lens crystallins. Biochim. Biophys. Acta 832: 197–203.[CrossRef][Medline]

Liu B.F. and Liang J.J. 2005. Interaction and biophysical properties of human lens Q155* B2-crystallin mutant. Mol. Vis. 11: 321–327.[Medline]

Liu C. and Welsh M.J. 1999. Identification of a site of Hsp27 binding with Hsp27 and B-crystallin as indicated by the yeast two-hybrid system. Biochem. Biophys. Res. Commun. 255: 256–261.[CrossRef][Medline]

Liu H., Du X., Wang M., Huang Q., Ding L., McDonald H.W., Yates III J.R., Beutler B., Horwitz J., Gong X. 2005. Crystallin B-I4F mutant protein binds to -crystallin and affects lens transparency. J. Biol. Chem. 280: 25071–25078.[Abstract/Free Full Text]

Mach H., Middaugh C.R., Lewis R.V. 1992. Statistical determination of the average values of the extinction coefficients of tryptophan and tyrosine in native proteins. Anal. Biochem. 200: 74–80.[CrossRef][Medline]

Narahara M., Tachibana K., Kurisu N., Kanazawa M., Miyake M. 2000. Immunohistochemical and chemical changes of -citryl-L-glutamate in the differentiation of bovine lens epithelial cells into lens fiber cells. Biol. Pharm. Bull. 23: 704–707.[Medline]

Perng M.D., Muchowski P.J., van den I.P., Wu G.J., Hutcheson A.M., Clark J.I., Quinlan R.A. 1999. The cardiomyopathy and lens cataract mutation in B-crystallin alters its protein structure, chaperone activity, and interaction with intermediate filaments in vitro. J. Biol. Chem. 274: 33235–33243.[Abstract/Free Full Text]

Putilina T., Skouri-Panet F., Prat K., Lubsen N.H., Tardieu A. 2003. Subunit exchange demonstrates a differential chaperone activity of calf -crystallin toward LOW- and individual -crystallins. J. Biol. Chem. 278: 13747–13756.[Abstract/Free Full Text]

Sobott F., Benesch J.L., Vierling E., Robinson C.V. 2002. Subunit exchange of multimeric protein complexes. Real-time monitoring of subunit exchange between small heat shock proteins by using electrospray mass spectrometry. J. Biol. Chem. 277: 38921–38929.[Abstract/Free Full Text]

Sreelakshmi Y., Santhoshkumar P., Bhattacharyya J., Sharma K.K. 2004. A-crystallin interacting regions in the small heat shock protein, B-crystallin. Biochemistry 43: 15785–15795.[Medline]

Steer B.A. and Merrill A.R. 1994. The colicin E1 insertion-competent state: Detection of structural changes using fluorescence resonance energy transfer. Biochemistry 33: 1108–1115.[CrossRef][Medline]

Sun T.X. and Liang J.J. 1998. Intermolecular exchange and stabilization of recombinant human A- and B-crystallin. J. Biol. Chem. 273: 286–290.[Abstract/Free Full Text]

Sun T.X., Das B.K., Liang J.J. 1997. Conformational and functional differences between recombinant human lens A- and B-crystallin. J. Biol. Chem. 272: 6220–6225.[Abstract/Free Full Text]

Sun T.X., Akhtar N.J., Liang J.J. 1998. Subunit exchange of lens -crystallin: A fluorescence energy transfer study with the fluorescent labeled A-crystallin mutant W9F as a probe. FEBS Lett. 430: 401–404.[CrossRef][Medline]

Swaim C.L., Smith D.L., Smith J.B. 2004. The reaction of -crystallin with the cross-linker3,3'-dithiobis(sulfosuccinimidyl propionate) demonstrates close proximity of the C termini of A and B in the native assembly. Protein Sci. 13: 2832–2835.[Abstract/Free Full Text]

van den Oetelaar P.J., van Someren P.F., Thomson J.A., Siezen R.J., Hoenders H.J. 1990. A dynamic quaternary structure of bovine -crystallin as indicated from intermolecular exchange of subunits. Biochemistry 29: 3488–3493.[CrossRef][Medline]

Vanhoudt J., Aerts T., Abgar S., Clauwaert J. 1998. Quaternary structure of bovine -crystallin: Influence of temperature. Int. J. Biol. Macromol. 22: 229–237.[CrossRef][Medline]

Vanhoudt J., Abgar S., Aerts T., Clauwaert J. 2000. Native quaternary structure of bovine -crystallin. Biochemistry 39: 4483–4492.[CrossRef][Medline]

Wu P. and Brand L. 1994. Resonance energy transfer: Methods and applications. Anal. Biochem. 218: 1–13.[CrossRef][Medline]

CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				J.-h. Xi, F. Bai, J. Gross, R. R. Townsend, A. S. Menko, and U. P. Andley Mechanism of Small Heat Shock Protein Function in Vivo: A KNOCK-IN MOUSE MODEL DEMONSTRATES THAT THE R49C MUTATION IN {alpha}A-CRYSTALLIN ENHANCES PROTEIN INSOLUBILITY AND CELL DEATH J. Biol. Chem., February 29, 2008; 283(9): 5801 - 5814. [Abstract] [Full Text] [PDF]

				Y. Shi, D.-J. Fan, S.-X. Li, H.-J. Zhang, S. Perrett, and J.-M. Zhou Identification of a potential hydrophobic peptide binding site in the C-terminal arm of trigger factor Protein Sci., June 1, 2007; 16(6): 1165 - 1175. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: ps.062216006v1 15/7/1619    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liang, J. J. Articles by Liu, B.-F. Search for Related Content PubMed PubMed Citation Articles by Liang, J. J.