|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Molecular Biology Institute and Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, California 90095, USA
2 X-Ray Diffraction Facility, Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA
3 Department of Microbiology and Immunology, Penn State College of Medicine, Hershey, Pennsylvania 17033, USA
4 Infectious and Inflammatory Disease Center, The Burnham Institute for Medical Research, La Jolla, California 92037, USA
(RECEIVED March 7, 2006; FINAL REVISION May 26, 2006; ACCEPTED May 28, 2006)
| Abstract |
|---|
|
|
|---|
Keywords: viral assembly; complementation; temperature-sensitive mutants; SV40; capsid
| Introduction |
|---|
|
|
|---|
450 Å in diameter with icosahedral symmetry. Viral capsids contain 360 copies of a major structural protein, Vp1, arranged as 72 pentameric building blocks on the viral surface (Rayment et al. 1982). Mature virus particles also contain
72 copies of the minor structural proteins Vp2 and Vp3; four host histones (H2A, H2B, H3, and H4); and the viral genome, a double-stranded, circular DNA of about 5200 base pairs, together forming a "minichromosome." The capsid structure is known as atomic resolution (Liddington et al. 1991; Stehle et al. 1996). The all-pentamer organization requires that the interactions between pentamers holding the capsid together cannot conform to the Caspar-Klug rules of quasisymmetry (Caspar and Klug 1962). Instead, the capsid is tied together by long C-terminal arms (C-arms) that emanate from each Vp1 and invade a neighboring pentamer. The arms adopt alternate conformations between pentamers, but at their distal ends they adopt identical conformations, wrapping around the body of a neighboring pentamer and inserting into a clamp that ends at a dual Ca2+ binding site. Five Ca2+-coordinating acidic residues are critical for the formation of an infectious particle (Li et al. 2003). Assembly of the closely related polyomavirus Vp1 pentamer in vitro also requires Ca2+ ions (Salunke et al. 1986). The crystal structure of a Vp1 pentamer in complex with a fragment of the common C-terminal segment of Vp2 and Vp3 (hereafter referred to as Vp3) has been determined for polyomavirus (Chen et al. 1998). The Vp3 fragment inserts into the axial cavity of the pentamer, and both the N- and C-terminal ends extend toward the interior of the virus. The Vp3 fragment is nearly identical in sequence to that of SV40, as is the interaction site on Vp1, which is therefore likely to bind Vp3 in an analogous fashion. One Vp1 pentamer bound to one Vp3 is presumed to initiate condensation of the minichromosome for virion assembly in the nucleus. Assembly occurs sequentially, with capsid proteins arranging themselves on the viral minichromosome (Garber et al. 1978, 1980; Baumgartner et al. 1979; Coca-Prados and Hsu 1979; Fernandez-Munoz et al. 1979; Fanning and Baumgartner 1980; Jakobovits and Aloni 1980; La Bella and Vesco 1980). Correct icosahedral virion assembly requires selecting specific intrapentamer and interpentamer bonding, calcium binding, and possibly Vp3 interaction.
Three classes of temperature-sensitive (ts) mutants have been defined within the Vp1 gene: ts B, ts C, and ts BC (Tegtmeyer and Ozer 1971; Chou and Martin 1974; Dubbs et al. 1974; Lai and Nathans 1974; Robb et al. 1974; Tevethia et al. 1974; Tevethia and Ripper 1977; Noonan and Butel 1978; Cosman and Tevethia 1981; Mertz 1984). ts B mutants complement ts C mutants, while ts BC mutants do not complement other mutants (Chou and Martin 1974, 1975; Lai and Nathans 1975, 1976). Lai and Nathan have proposed that complementation occurs at the protein level, but the molecular basis has not been explained. The block in assembly of ts mutants leads to the accumulation of two classes of assembly intermediates: 75S particles comprising SV40 minichromosomes with little or no capsid proteins, and 100160S intermediates with extensive association of capsid proteins (Garber et al. 1978, 1980; Bina et al. 1983a,b; Blasquez et al. 1983; Ng and Bina 1984). In contrast, mature virions have a sedimentation coefficient of 240S. Based on the observation of the intermediates, nuclear virion assembly has been proposed to proceed in an orderly and stepwise fashion involving the addition of structural proteins to an SV40 minichromosome (Garber et al. 1978, 1980; Bina et al. 1983a; Blasquez et al. 1983; Ng and Bina 1984). Mapping the ts mutants onto the capsid structure has allowed us to correlate them with their phenotypes, provide a rationale for intracistronic (that is, within one gene) complementation, and to provide further clues into the assembly process.
| Results and Discussion |
|---|
|
|
|---|
|
|
|
-sheet, creating the acceptor site for the proximal part of the invading C-arm), as well as surrounding loops on the middle and upper surface of the pentamer. All 10 ts B mutations and four out of five ts BC mutations map to this region (Fig. 1). Of these, three ts B mutations (at Gly 163, Ala 166, and Ala 195) and three ts BC mutations (at Thr 170, His 193, and Asp 200) map to the jelly-roll domain itself; four ts B mutations (at Gln 54, Pro 58, Glu 83, and Ala 71) and one ts BC mutation (at Pro 283) map to loops and strands that make direct contact with the jelly roll domain; three ts B mutations (at His 136, Gly 139, and Ser 147) are more distant, and map to loops that interlock neighboring monomers at the top of the pentamer. Region I mutants share a common phenotype at the nonpermissive temperature: a defect in assembly leading to the accumulation of intermediates of heterogeneous size (100160S) carrying substantial amounts of Vp1 (Table1) (Bina et al. 1983a,b; Blasquez et al. 1983). Given the conserved phenotype and spatial clustering of the Region I mutations, the structural basis for the assembly defect is likely to have the same origin: compromised pentamerpentamer contacts that are mediated by the proximal part of the invading arm. In 11 out of 14 cases, this appears to be fairly direct, while in three other cases we surmise that the effect is mediated through a more global effect on pentamer integrity. The presence of substantial amounts of capsid proteins in the assembly intermediates suggests that the initial interaction of pentamers with Vp3 and the minichromosome, as well as cross-linking of the distal part of the invading arms with the clamp and Ca2+ binding sites, can proceed with some efficiency. However, we suggest that subsequent steps in assembly, which require correct choices among twofold and threefold subassemblies, are compromised.
The Ca2+ binding sites and distal C-arm interactions are required for the initiation of minichromosome packaging
Region II mutations cluster at the base of the pentamer: the region includes the clamp for the distal part of the C-arm, the two Ca2+ binding sites that cross-link arms from three pentamers, and residues that lie between the Ca2+ sites and the Vp3 binding surface (Figs. 1, 2). Region II mutants comprise all four ts C mutants and one of the ts BC mutants (at Lys 287) (Table 1). Assembly intermediates of three out of the four ts C mutants and the ts BC mutant have been reported: they all have a severe assembly defect with few viral proteins attached to the minichromosome (Table 1; Garber et al. 1978, 1980; Bina et al. 1983a,b; Ng and Bina 1984). Closer inspection of the mutants shows that some are clearly predicted to disturb salt bridges that maintain the integrity of the Ca2+ binding sites (Fig. 2). This is consistent with our previous finding that mutations of Ca2+-coordinating residues can profoundly affect particle assembly (Li et al. 2003).
For other region II mutations, notably at Leu 244 and Pro 252, it is possible that the assembly defects arise from disturbing the interaction with Vp3 (Fig. 2). Leu 244 and Pro 252 are on the G strand, and orient a small seven-amino acid loop, colored green in Figure 2; two such loops, from neighboring Vp1 monomers within the pentamer, make contact with the two ends of the Vp3 helix. The mutations may dislocate these loops, affecting the Vp1Vp3 interaction. However, Leu 244 also packs against Pro 252, which in turn, packs against the loop containing the Site II Ca2+ coordinating residue, Glu 157, whose integrity influences virion assembly (Li et al. 2003). We therefore cannot distinguish between these two sources of the assembly defect by simple inspection of the structure. However, we have studied the role of Vp3 in virion formation by mutating the Vp1Vp3 contact sites predicted by our three-dimensional model (see Materials and Methods), and shown that virion assembly can occur in the presence of small or negligible amounts of Vp3 (Nakanishi et al. 2006). While this preliminary result favors the notion that disruption of the Ca2+ coordination sites has a greater effect on capsid assembly than disruption of Vp1Vp3 interactions, it does not formally rule out the possibility that a dysfunctional (rather than absent) Vp1Vp3 interaction could be the cause of aberrant capsid assembly in the case of Leu 244 and Pro 252 mutations.
Given the consistent and severe assembly defects of the Region II mutants, we speculate that pentamerpentamer cross-linking mediated by the distal parts of the invading C-arms and the Ca2+ binding sites is a critical early step in the addition of pentamers to the minichromosome. Previous work from others has identified the importance of calcium in stabilizing the structure of preassembled particles (Brady et al. 1977; Christiansen et al. 1977; Stehle et al. 1996). Furthermore, we have previously described a Ca2+-coordinating mutant, E330K, which forms particles but is unable to bind cells or penetrate into the cytoplasm (Li et al. 2003), and proposed that the substituted lysine makes salt bridges with the side chains of the Ca2+-coordinating Glu 48 and Glu 216, thus displacing the Ca2+ ion from site 1. We hypothesize that the failure of this mutant to infect cells arises from its inability to break this salt bridge. Therefore, our work provides further support for the role of Ca2+ ions, both their binding and release, in multiple steps of the viral life cycle.
Structural basis for intracistronic complementation
The existence of two classes of mutants that are structurally distinct and that influence virion assembly in distinct and consistent ways may provide a rationale for the ability of certain ts B and ts C mutants to complement each other. Complementation analysis was established to facilitate the genetic analysis of a number of ts mutants of SV40, and revealed the presence of more than one complementation group in genes that are expressed late in viral infection (Tegtmeyer and Ozer 1971; Chou and Martin 1974). The two complementation groups, ts B and ts C arise from mutations in one gene (encoding Vp1), and thus complementation is termed "intracistronic." Such complementation occurs when two mutants are introduced simultaneously into a cell and allowed to replicate through multiple rounds of infection (Tevethia et al. 1974, 1981; Tevethia and Ripper 1977; Cosman and Tevethia 1981), enabling the mixing of mutants Vp1 pentamers synthesized in the cytoplasm prior to transport into the nucleus. Complementation does not occur when viral replication is limited to a single replication cycle at the restrictive temperature (Tevethia et al. 1974, 1981; Tevethia and Ripper 1977; Cosman and Tevethia 1981), since no such mixing of mutant pentamers can occur. To provide a molecular rationale for this complementation, we examined the relationship between pairs of mutants in which intracistronic complementation has been documented (Table 2; Chou and Martin 1974; Tevethia and Ripper 1977; Tevethia et al. 1981). We find that all known complementing pairs carry amino acid substitutions in distinct structural regions (i.e., one in region I, the other in region II).
|
| Materials and methods |
|---|
|
|
|---|
3050 ng of the mutant DNAs (0.0140.026 µg/µL, stored at 20°C) as template DNA. Herculase DNA polymerase (Stratagene) and 2 mM dNTPs were used. The initial denaturation was performed at 92.0°C for 2 min, followed by 30 cycles of the following: 92.0°C for 30 sec, renaturation at 55.0°C for 30 sec, and extension for 1 min at 72°C, with the final extension at 72°C for 10 min. The reaction was done in triplicates for assurance of the nucleotide alteration. For ts C1641, a Hirt lysate of cells infected with the mutant was used as the template. For ts B1602, ts B1603, ts BC1606, ts BC1607, and ts BC1640, the following two primer pairs were used: forward 5' 16231641 (CTGGAGTAGACAGCTTCAC) and reverse 5' 21822163 (TGTGTAGGTTCCAAAATATCTA), and forward 5' 15671581 (AGTGCAAGTGCCAAA) and reverse 5' 26662652 (CTTGTTTATTGCAGC). The first primer set was used initially to amplify just the F region, while the second primer set amplified a larger region including the F fragment, yielding equivalent levels of amplification. Sequencing of the PCR products was performed as instructed by Laragen using 5' 15671581 (AGTGCAAGTGCCAAA) and 5' 21882163 (CCCACCTGTGTAGGTTCCAAAA). For ts BC1605 and ts C1641, the entire Vp1 gene was amplified using forward 5' 13201339 (CAGTATTCAGCAAGTAACTG) and reverse 5' 26662652 primers, followed by sequencing using 5' 13201339 for ts C1641 and 5' 26712652 (GTTAACTTGTTTATTGCAGC) for ts B1605.
A homology model of the SV40 Vp1 pentamerVp3 complex
The crystal structure of the polyomavirus Vp1 pentamerVp3 complex is known (Chen et al. 1998), and the structure of SV40 and polyomavirus pentamers are well conserved (Liddington et al. 1991; Stehle et al. 1994, 1996). Based on these structures (PDB codes 1CN3 and 1SVA) we built a homology model in the following way. The polyoma complex was superimposed onto the Vp1 pentamer of SV40 by overlaying the C
positions of the
-sheets of Vp1 (the backbone can be superimposed with a root-mean-square deviation of
0.5 Å). The ordered region of Vp3 observed in the polyoma structure (151187) is highly conserved within SV40 Vp3 (154187), and the side chains with library torsion angles were replaced with their SV40 counterparts using TURBO-FRODO. In this model, the first ordered residue of the Vp3 fragment is Phe 157. Phe 157 and Ile 158 nestle into the hydrophobic neck at the top of the conical interior of one Vp1 pentamer. Residues upstream of Phe 157 may extend through the neck and be exposed on the surface of the virion, or fold back toward the base of the Vp1 pentamer, as suggested by Chen et al. (1998). Residues Pro 164, Gly 165, and Gly 166 form a tight turn where they pack into a crevice between the two main
-sheets of Vp1. Residues Trp 175 through Tyr 184 form a hydrophobic
-helix at the base of the pentamer. Vp3 residues Leu 177 and Leu 181 make hydrophobic contacts with Vp1 residues Val 243 and Leu 245, respectively. Based on this model we altered Vp3 residues (Phe 157, Ile 158, Pro 164, Gly 165, Gly 166, Leu 177, and Leu 181) and Vp1 residues (Val 243 and Leu 245), and determined the effect of substitutions on the Vp1Vp3 interaction and on infectivity of the mutant particles to the new host. The mutations either reduced or eliminated the incorporation of minor capsid proteins into mutant particles. The loss of minor capsid proteins in the particles accompanied the reduction in viability, and the particles with no detectable Vp3 were nearly noninfectious (Nakanishi et al. 2006), indicating that the SV40 homology model constructed here reflects the Vp1Vp3 interaction occurring in vivo. The Vp1Vp3 complex was built and inspected using TURBO-FRODO (http://afmb.cnrs-mrs.fr/rubrique113.html). Figures were made using PyMOL Molecular Graphics System (DeLano 2002,http://www.pymol.org). The model of the Vp1Vp3 complex, as well as a detailed description of the environments of all the mutations sites, is available from the corresponding author on request.
| Footnotes |
|---|
Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.062195606.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Behm M., Lowman H., Ng S.C., Bina M. 1988. Analysis of temperature-sensitive mutations in the simian virus 40 gene encoding virion protein 1. Proc. Natl. Acad. Sci. 85: 94219425.
Bina M., Blasquez V., Ng S.C., Beecher S. 1983a. SV40 morphogenesis. Cold Spring Harb. Symp. Quant. Biol. 47: 565569.
Bina M., Ng S.C., Blasquez V. 1983b. Simian virus 40 chromatin interaction with the capsid proteins. J. Biomol. Struct. Dyn. 1: 689704.[Medline]
Blasquez V., Beecher S., Bina M. 1983. Simian virus 40 morphogenetic pathway. An analysis of assembly-defective tsB201 DNA protein complexes. J. Biol. Chem. 258: 84778484.
Brady J.N., Winston V.D., Consigli R.A. 1977. Dissociation of polyoma virus by the chelation of calcium ions found associated with purified virions. J. Virol. 23: 717724.
Caspar D.L. and Klug A. 1962. Physical principles in the construction of regular viruses. Cold Spring Harb. Symp. Quant. Biol. 27: 124.[Medline]
Chen X.S., Stehle T., Harrison S.C. 1998. Interaction of polyomavirus internal protein VP2 with the major capsid protein VP1 and implications for participation of VP2 in viral entry. EMBO J. 17: 32333240.[CrossRef][Medline]
Chou J.Y. and Martin R.G. 1974. Complementation analysis of simian virus 40 mutants. J. Virol. 13: 11011109.
Chou J.Y. and Martin R.G. 1975. Products of complementation between temperature-sensitive mutants of simian virus 40. J. Virol. 15: 127136.
Christiansen G., Landers T., Griffith J., Berg P. 1977. Characterization of components released by alkali disruption of simian virus 40. J. Virol. 21: 10791084.
Coca-Prados M. and Hsu M.T. 1979. Intracellular forms of simian virus 40 nucleoprotein complexes. II. Biochemical and electron microscopic analysis of simian virus 40 virion assembly. J. Virol. 31: 199208.
Cosman D.J. and Tevethia M.J. 1981. Characterization of a temperature-sensitive, DNA-positive, nontransforming mutant of simian virus 40. Virology 112: 605624.[CrossRef][Medline]
Dubbs D.R., Rachmeler M., Kit S. 1974. Recombination between temperature-sensitive mutants of simian virus 40. Virology 57: 161174.[CrossRef][Medline]
Fanning E. and Baumgartner I. 1980. Role of fast-sedimenting SV40 nucleoprotein complexes in virus assembly. Virology 102: 112.[CrossRef][Medline]
Fernandez-Munoz R., Coca-Prados M., Hsu M.T. 1979. Intracellular forms of simian virus 40 nucleoprotein complexes. I. Methods of isolation and characterization in CV-1 cells. J. Virol. 29: 612623.
Garber E.A., Seidman M.M., Levine A.J. 1978. The detection and characterization of multiple forms of SV40 nucleoprotein complexes. Virology 90: 305316.[CrossRef][Medline]
Garber E.A., Seidman M.M., Levine A.J. 1980. Intracellular SV40 nucleoprotein complexes: Synthesis to encapsidation. Virology 107: 389401.[CrossRef][Medline]
Ishii N., Nakanishi A., Yamada M., Macalalad M.H., Kasamatsu H. 1994. Functional complementation of nuclear targeting-defective mutants of simian virus 40 structural proteins. J. Virol. 68: 82098216.
Jakobovits E.B. and Aloni Y. 1980. Isolation and characterization of various forms of simian virus 40 DNAprotein complexes. Virology 102: 107118.[CrossRef][Medline]
La Bella F. and Vesco C. 1980. Late modifications of simian virus 40 chromatin during the lytic cycle occur in an immature form of virion. J. Virol. 33: 11381150.
Lai C.J. and Nathans D. 1974. Mapping temperature-sensitive mutants of simian virus 40: Rescue of mutants by fragments of viral DNA. Virology 60: 466475.[CrossRef][Medline]
Lai C.J. and Nathans D. 1975. A map of temperature-sensitive mutants of simian virus 40. Virology 66: 7081.[CrossRef][Medline]
Lai C.J. and Nathans D. 1976. The B/C gene of simian virus 40. Virology 75: 335345.[CrossRef][Medline]
Li P.P., Naknanishi A., Tran M.A., Ishizu K., Kawano M., Phillips M., Handa H., Liddington R.C., Kasamatsu H. 2003. Importance of Vp1 calcium-binding residues in assembly, cell entry, and nuclear entry of simian virus 40. J. Virol. 77: 75277538.
Liddington R.C., Yan Y., Moulai J., Sahli R., Benjamin T.L., Harrison S.C. 1991. Structure of simian virus 40 at 3.8-Å resolution. Nature 354: 278284.[CrossRef][Medline]
Mertz J.E. 1984. A detailed genetic analysis of the late complementation groups of simian virus 40. Virology 132: 173185.[CrossRef][Medline]
Nakanishi A., Nakamura A., Liddington R., Kasamatsu H. 2006. Identification of amino acid residues within simian virus 40 capsid proteins Vp1, Vp2 and Vp3 that are required for their interaction and for viral infection. J. Virol. (in press).
Ng S.C. and Bina M. 1984. Temperature-sensitive BC mutants of simian virus 40: Block in virion assembly and accumulation of capsidchromatin complexes. J. Virol. 50: 471477.
Noonan C.A. and Butel J.S. 1978. Temperature-sensitive mutants of simian virus 40 I. Isolation and preliminary characterization of B/C gene mutants. Intervirology 10: 181195.[Medline]
Rayment I., Baker T.S., Caspar D.L., Murakami W.T. 1982. Polyoma virus capsid structure at 22.5 Å resolution. Nature 295: 110115.[CrossRef][Medline]
Robb J.A., Tegtmeyer P., Ishikawa A., Ozer H.L. 1974. Antigenic phenotypes and complementation groups of temperature-sensitive mutants of simian virus 40. J. Virol. 13: 662665.
Salunke D.M., Caspar D.L., Garcea R.L. 1986. Self-assembly of purified polyomavirus capsid protein VP1. Cell 46: 895904.[CrossRef][Medline]
Stehle T. and Harrison S.C. 1997. High-resolution structure of a polyomavirus VP1-oligosaccharide complex: Implications for assembly and receptor binding. EMBO J. 16: 51395148.[CrossRef][Medline]
Stehle T., Yan Y., Benjamin T.L., Harrison S.C. 1994. Structure of murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature 369: 160163.[CrossRef][Medline]
Stehle T., Gamblin S.J., Yan Y., Harrison S.C. 1996. The structure of simian virus 40 refined at 3.1 Å resolution. Structure 4: 165182.[Medline]
Tegtmeyer P. and Ozer H.L. 1971. Temperature-sensitive mutants of simian virus 40: Infection of permissive cells. J. Virol. 8: 516524.
Tevethia M.J. and Ripper L.W. 1977. Biology of simian virus 40 (SV40) transplantation antigen (TrAg) II. Isolation and characterization of additional temperature-sensitive mutants of SV40. Virology 81: 192211.[CrossRef][Medline]
Tevethia M.J., Ripper L.W., Tevethia S.S. 1974. A simple qualitative spot complementation test for temperature-sensitive mutants of SV40. Intervirology 3: 245255.[Medline]
Tevethia M.J., Slippey A.E., Cosman D.J. 1981. Mapping of additional temperature-sensitive mutations (1600 series) on the genome of simian virus 40 by marker rescue. Virology 112: 789794.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
A. Nakanishi, N. Itoh, P. P. Li, H. Handa, R. C. Liddington, and H. Kasamatsu Minor Capsid Proteins of Simian Virus 40 Are Dispensable for Nucleocapsid Assembly and Cell Entry but Are Required for Nuclear Entry of the Viral Genome J. Virol., April 15, 2007; 81(8): 3778 - 3785. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |