|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Biosciences, University of Kansas, Lawrence, Kansas 66045, USA
2 Department of Pharmaceutical Chemistry, University of Kansas, Lawrence, Kansas 66045, USA
(RECEIVED November 1, 2006; FINAL REVISION January 12, 2007; ACCEPTED January 12, 2007)
| Abstract |
|---|
|
|
|---|
-helical with properties consistent with an intramolecular coiled-coil. SipD showed the most complex unfolding profile consisting of two thermal transitions, suggesting the presence of two independently folding domains. No evidence of multiple folding domains was seen, however, for BipD, LcrV, or PcrV. Thermal studies, including DSC, revealed significant destabilization of LcrV, PcrV, and BipD after N-terminal deletions. This contrasted with SipD and IpaD, which behaved like two-domain proteins. The results suggest that needle tip proteins share significant core structural similarity and thermal stability that may be the basis for their common function. Moreover, IpaD and SipD possess properties that distinguish them from the other tip proteins. Keywords: tip proteins; T3SS; biophysical analysis; IpaD; SipD; BipD; LcrV; PcrV
| Introduction |
|---|
|
|
|---|
Sometimes described as a "molecular syringe and needle," the T3SA is composed of 2030 proteins that form a basal body spanning the inner and outer bacterial membranes and an external needle (He et al. 2004; Yip and Strynadka 2006). The external needle is a hollow tube
50 nm long and 7 nm in diameter with an inner channel that is typically
2.5 nm in diameter (Cordes et al. 2003). It is composed of >100 copies of a needle protein with 5.6 molecules per turn of the helix (Cordes et al. 2003). How proteins are prevented from free passage through the needle and how signals are sent from the needle tip to the base to trigger secretion are still unanswered questions.
Recently, a significant step toward answering these questions was made with the identification of a protein that resides at the T3SA needle tip (Mueller et al. 2005; Espina et al. 2006b). For S. flexneri, invasion plasmid antigen D (IpaD) was shown to stably reside at the tip of the TTSA needle, with this localization being required for T3SS secretion control and virulence-related functions (Espina et al. 2006b). Similarly, in Y. enterocolitica, LcrV localizes to the tip to form a distinct complex (Mueller et al. 2005). In addition to functioning as the needle tip proteins for their cognate T3SAs, IpaD and LcrV are required for translocator protein insertion into host cell membranes (Fields et al. 1999; Marenne et al. 2003; Picking et al. 2005).
Despite their functional homology as needle tip proteins, IpaD and LcrV share very little primary sequence similarity. There is significant sequence conservation, however, among members within the IpaD or LcrV needle tip protein subfamilies, respectively, especially at the C termini (see Fig. 1). The closest relatives of IpaD are the invasion proteins SipD and BipD of S. typhimurium and B. pseudomallei, respectively. Like ipaD-null mutants, sipD- and bipD-null mutants are noninvasive, with the sipD strain secreting massive amounts of T3SS effectors (Kaniga et al. 1995; Stevens et al. 2004). These three proteins share >25% sequence similarity, with >90% sequence similarity at their C termini (Kaniga et al. 1995). Similarly, lcrV and the P. aeruginosa pcrV-null mutants are defective for proper type III secretion and show 42% sequence identity, with most of this being within their C termini (Nanao et al. 2003). The crystal structures of LcrV (Derewenda et al. 2004) and, more recently, IpaD and BipD (Erskine et al. 2006; Johnson et al. 2007) have been solved and exhibit a dumbbell-like shape with two globular domains separated by a long coiled-coil. Previously, biophysical measurements have demonstrated that IpaD has two independently folding units with a thermally labile N-terminal and a more thermally stable C-terminal domain containing a coiled-coil (Espina et al. 2006a). Based on the structural and functional conservation between IpaD and LcrV and the high degree of sequence homology within the subfamilies, structural similarities may exist among all of the needle tip proteins that are required for their ability to localize to the needle tip.
|
-helical with an intramolecular coiled-coil. Only SipD, however, appeared to possess an independently folding N-terminal domain that is analogous to that of IpaD. Based on these results, we propose that, although having divergent primary sequences, all T3SA tip proteins possess similar structural features that are required for their needle tip localization as well as distinct features necessary for their pathogen-specific activities. | Results |
|---|
|
|
|---|
-helical protein that contains two independently folding domains. The N-terminal domain (residues 1120) is thermally labile, while the C-terminal domain (residues 121332) is more stable and contains an intramolecular coiled-coil. Based on the functional similarities between IpaD and the putative T3SA tip proteins, a series of biophysical studies was initiated to compare the structures and conformational stabilities of SipD, BipD, LcrV, and PcrV. Shared structurefunction relationships among these proteins might then be extrapolated to all T3SA tip proteins. To assess the impact of the N-terminal region on the four proteins, deletions were made to mimic the IpaD N-terminal deletion. Based on its crystal structure (Derewenda et al. 2004), an LcrV N-terminal deletion mutant was made by deleting the N-terminal domain prior to the intramolecular coiled-coil, giving rise to LcrV
1146. Although the crystal structure of PcrV has not been solved, pcrV can complement an lcrV-null mutant (Mueller et al. 2005), indicating that the core structure of the two proteins should be similar. Thus, the PcrV N-terminal deletion PcrV
1127 was based on an estimate of the location of the boundary between the putative N-terminal domain and coiled-coil region. In contrast, when this study was initiated, none of the crystal structures for the IpaD subfamily had been solved. Therefore, SipD
1121 and BipD
1123 were produced based on the previous IpaD
1120 results. Like the full-length proteins, the deletion mutants were highly soluble when made recombinantly in Escherichia coli.
Secondary structure analysis of SipD, BipD, LcrV, and PcrV
Far-UV CD was initially used to analyze the secondary structure and thermostability of SipD, BipD, LcrV, and PcrV as well as the N-terminal deletion mutants. The CD spectrum for each protein displays double minima at 208 nm and 222 nm, suggesting a significant amount of helical structure (Fig. 1). Their secondary structure contents were estimated from the far-UV CD spectra using the Dichroweb suite of algorithms (Lobley et al. 2002; Whitmore and Wallace 2004) with the program CDSSTR (Manavalan and Johnson Jr. 1987). As previously observed for IpaD (Espina et al. 2006a), these proteins appear to possess a high percentage of
-helical structure with some
-sheet and disordered structure being present (Table 1). Previous studies of PcrV estimated a lower percentage of helical structure (18%) compared to that obtained in the present work (58%) (Nanao et al. 2003). This may be at least partially due to the different experimental temperatures and methods used to estimate the secondary structure content. The N-terminal deletion mutations of these proteins showed CD spectra similar to those of full-length proteins (Fig. 2), indicating fully folded proteins with no major changes in the global folding of the proteins as a result of the truncations. Like IpaD
1120, SipD
1121 and PcrV
1127 displayed a greater relative amount of helical structure than their full- length counterparts (Table 1), which may indicate that the N-terminal regions of these proteins possess less helical character (Espina et al. 2006a). In contrast, BipD
1123 and LcrV
1146 displayed a lower relative amount of
-helix with an increasing percentage of
-sheet and random structures.
|
|
57°C and 75°C, respectively, suggesting the presence of two independently folded domains (Fig. 2; Table 2). The SipD
1121 mutant only displayed the major transition, suggesting that the structural domain responsible for the low-temperature minor transition resides near the N terminus of SipD, which is similar to the transition pattern observed for IpaD (Espina et al. 2006a). In contrast, BipD, LcrV, and PcrV display a single transition, with BipD and LcrV being the most stable with transition midpoints around 80°C. In good agreement with previous results (Nanao et al. 2003), PcrV displayed a transition midpoint around 65°C. In general, N-terminal deletions introduced into BipD, LcrV, and PcrV resulted in a decrease in thermal stability (Fig. 2; Table 2).
|
1616 cm1 and a weak signal at
1680 cm1 were common features for all proteins upon heating (Fig. 3B). These particular bands are characteristic of protein aggregation due to the formation of intermolecular
-sheets (Arrondo et al. 1994; Murayama and Tomida 2004). For BipD and SipD, the observed aggregation seems to be influenced by protein concentration, since it was not detected in more dilute solutions of the proteins during turbidity experiments (see below). Although FTIR experiments require samples with a much higher protein concentration than CD, an analysis of the thermal stability of the proteins based on the intensity of the 1616 cm1 band showed transition temperatures similar to those detected by CD spectroscopy (Fig. 3C).
|
|
1146 does not contain a Trp residue and was therefore not further analyzed by this technique. Intrinsic Trp fluorescence is highly environmentally sensitive and is widely used to monitor changes in Trp microenvironments resulting from alterations in protein tertiary structure. Exposure to more polar environments generally results in Trp emission being shifted to a longer wavelength (red shift), while movement into more apolar regions produces a blue shift (Lakowicz 1983). The Trp emission spectra of the full-length proteins and three of the N-terminal deletion mutants manifest a maximum between 328 and 336 nm, indicating that the tryptophans are on average buried within the apolar core of the needle tip proteins. In contrast, the emission maximum for SipD
1121 was red shifted
5 nm with respect to the spectrum of the full-length protein (Fig. 4A), suggesting at least partial exposure of the Trp in this mutant. In response to increasing temperature, the Trp emission wavelength maximum for SipD (Fig. 4A) red-shifted significantly and displayed two thermal transitions centered at
57°C and 74°C. These values agree well with those detected by CD analysis (Table 2). In contrast, SipD
1121 only exhibited a single broad transition between 65°C and 82°C, which is again consistent with the CD thermal unfolding data (Fig. 4A; Table 2). The overall observed red shift is consistent with increased solvent exposure of the Trp residues resulting from temperature-induced unfolding (Fig. 4A). BipD
1123 and PcrV
1127 showed overall destabilization of the molecule with lower T m values than the corresponding full-length proteins (Fig. 4A). The blue shift in the Trp emission maximum observed for LcrV and PcrV (Fig. 4A) at high temperatures is probably due to extensive aggregation of the proteins resulting from temperature-induced unfolding.
|
49°C and 68°C which were attributable to exposure of apolar regions caused by the conformational alterations within the two individual domains (Fig. 4B; Table 2). SipD
1121 showed a single transition near 70°C (Fig. 4B; Table 2), confirming the CD and intrinsic fluorescence observations (Fig. 4A). When the unfolding of full-length and N-terminal mutants of BipD, PcrV, and LcrV were evaluated by ANS fluorescence, the truncated proteins showed lower thermostability as evaluated by their T m values (Fig. 4B; Table 2), which again indicates a destabilizing effect on the proteins after truncation.
SipD, BipD, LcrV, and PcrV also possess substantial numbers of the aromatic amino acids tyrosine and phenylalanine. Changes in the microenvironments of these residues also induce changes in their spectral characteristics, thus providing a means for monitoring tertiary structure stability that is not completely dependent on the presence of scarce Trp residues. The second derivative spectra of the proteins showed five to six negative peaks with the following general assignments: Phe (
253 nm and 259 nm), Tyr (at 274 nm and 279 nm), an overlapping Tyr/Trp signal (at 282 nm), and Trp (at 291 nm) (spectra not illustrated). In general, exposure of aromatic amino acid side chains to a more polar environment causes a blue shift in the absorbance minimum, whereas shifts to longer wavelengths suggest that the residues are present in a more buried, less polar environment (Mach and Middaugh 1994). The Tyr/Trp signal was found to be the most well-behaved and superior in signal-to-noise ratio to the other peaks in the analysis of the protein's stability (Fig. 5). The Tyr/Trp peak positions of SipD and SipD
1121 show a quasilinear temperature-dependent decrease in wavelength before the thermal transition. Broad transitions around 71°C and 74°C were observed for SipD and SipD
1121, respectively, with an overall blue shift (Fig. 5A; Table 2). Surprisingly, this is the only technique of those used that does not clearly demonstrate a double transition for full-length SipD, suggesting that the N-terminal portion does not strongly impact the thermal response of this particular second derivative minimum. The Tyr/Trp peak positions of BipD and BipD
1123 remain relatively constant until 65°75°C, respectively, suggesting that the tertiary structure of the protein undergoes negligible changes up to this temperature (Fig. 5A). Above these temperatures, the Tyr/Trp peak positions shift to lower wavelengths, suggesting that the aromatic residues are becoming more exposed to the solvent, in good agreement with the intrinsic fluorescence observations (Fig. 4A). The noise in the signals observed in LcrV
1146 and PcrV
1127 at temperatures above the transition is almost certainly a consequence of the extensive aggregation detected for these proteins (Fig. 5B). In general, the transition temperatures agreed well with those seen for the transitions detected by CD spectroscopy (Table 2).
|
50°65°C depending on the protein, with well-defined transitions (Fig. 5B; Table 2). The drop in turbidity after the transition is due to settling of the precipitated aggregates within the cuvette. It is noteworthy that no aggregation was detected for SipD, BipD, and BipD
1123, which is similar to previous findings for IpaD and IpaD
1120 (Espina et al. 2006a).
Analysis of thermal unfolding by differential scanning calorimetry
Differential scanning calorimetry (DSC) is another useful method for analyzing the thermal unfolding of proteins with the potential to provide a direct energetic description of distinct protein unfolding events. The SipD thermogram was quite complex showing high-temperature (
85°90°C) transitions not detected by most spectroscopic techniques (Fig. 6). Although the protein displayed five distinct transitions, the T m for the first and third transitions agreed well with those values for the double transition detected by CD and fluorescence experiments (Table 2; Fig. 5). SipD
1121 displayed only the major and high-temperature transitions (Fig. 6). The rest of the proteins under study showed one endothermic transition (Fig. 6). Except for the BipD thermogram, the best fit using a non-two-state model was composed of two peaks for each protein (Table 4). N-terminal truncation of BipD, LcrV, and PcrV caused destabilization of the proteins with a 10°20°C drop in the T m values compared to those found for the respective full-length protein thermograms (Fig. 6; Table 4). Thus, DSC confirms the high thermal stability of these proteins, which is probably at least partially a result of the intramolecular coiled-coil. It also illustrates the presence of two independently folding domains that appears to be unique to IpaD and SipD. Lack of complete reversibility prevented calculation of the enthalpies of unfolding. Hints of a second transition are for the first time present using this technique for the other proteins.
|
|
| Discussion |
|---|
|
|
|---|
Based on the initial biophysical characterization of IpaD, it was anticipated that this subfamily of needle tip proteins would be highly
-helical and possess two independently folding domains, with the N-terminal third of the protein forming a thermally labile domain and the C-terminal two-thirds being more heat stable and containing a large intramolecular coiled-coil. SipD followed this pattern, but surprisingly BipD did not. BipD shares significant sequence identity with IpaD and SipD, especially within the C-terminal half of the protein, but it exhibits only one thermal unfolding transition that is even more stable than the higher of the two transitions seen for IpaD and SipD. FTIR analysis suggests that BipD possesses an intramolecular coiled-coil, but it may be somewhat different from that of IpaD and SipD because it exhibits spectral characteristics between that of a double- and triple-stranded coiled-coil (Heimburg et al. 1996, 1999). It is possible that the N-terminal region of BipD interacts more extensively with the intramolecular coiled-coil than do the N-terminal regions of IpaD or SipD. As a result, not only does the FTIR spectrum of BipD resemble a triple coiled-coil, but interaction of the N-terminal region with the coiled-coil may prevent the formation of a fully independently folding domain as seen with IpaD and SipD. This idea is corroborated by an overall thermal destabilization of BipD when the N-terminal region is removed. Indeed, during the preparation of this manuscript, the crystal structures of IpaD and BipD were solved (Erskine et al. 2006; Johnson et al. 2007). Like LcrV, IpaD and BipD have a dumbbell-like shape with globular domains flanking an intramolecular coiled-coil, which forms the handle. The N-terminal domain of IpaD forms a helixturnhelix that is almost identical in structure to MxiH, its cognate T3SA needle protein, followed by a short
-helix that attaches the domain to the coiled-coil. Based on the biophysical characterization, it appears that this domain is able to unfold and fold independently of the remainder of the protein. This property may be important for the virulence of Shigella. In contrast, the N-terminal domain of BipD is longer, with more of a loop rather than a turn. This loop appears to form a stronger interaction with the coiled-coil, which accounts for the apparent triple-stranded coiled-coil of BipD. Thus, although BipD does not possess the two independently folding domains structure of IpaD and SipD, it may have an N-terminal domain whose unique structural characteristics point to a unique biological function for this region of the protein.
The LcrV subfamily of needle tip proteins differs significantly from the members of the IpaD subfamily based on sequence, but the members share significant sequence similarity among themselves, especially in their C-terminal halves. In considering the published crystal structure of LcrV (Derewenda et al. 2004) in the context of the biophysical characteristics of the two subfamilies, it appears likely that the N-terminal domain of the LcrV subfamily does not exist as a well-defined, independently folding domain, making the native organization of the proteins of the two subfamilies different from one another. This may directly reflect the divergence in function between the two subfamilies. Furthermore, the lack of independent folding domains would also readily explain why deletion of the LcrV N-terminal domain and the putative PcrV N-terminal domain results in overall protein destabilization. Nevertheless, even these proteins continue to form highly folded, stable structures when the N-terminal deletion is introduced. This is probably because of the stable nature of the intramolecular coiled-coil that all of these tip proteins seem to possess.
It has been previously noted that the tip proteins can exist in various multimerization states. LcrV has been described to be a dimer and multimers thereof (Lawton et al. 2002). Similarly, the N-terminal truncation of IpaD that provided its original crystal was present as a dimer (Johnson et al. 2007). In this study, gel filtration chromatography showed that IpaD, SipD, and BipD elute as monomers, PcrV was primarily monomeric, and LcrV appeared to be present as both a monomer and dimer. In contrast, all of the N-terminal deletion mutants appear to behave as oligomers. Although oligomerization has been reported to occasionally provide increased thermal stability to a protein, this property was not apparent for the tip protein family upon deletion with the N-terminal domain since the second melting transition is lower than that of the full-length protein. Owing to the presence of multiple oligomerization states for LcrV, the impact of this property on the biophysical characterization of this protein cannot be directly assessed. The multimeric state of these proteins and deletion mutants is likely due to interactions involving the coiled-coil (Lawton et al. 2002; Johnson et al. 2007), a property required for proper oligomerization at the tip of the needle (Deane et al. 2006). Once the N-terminal domain has been removed, the coiled-coil is exposed, promoting spontaneous oligomerization.
The presence of coiled-coils and/or helices that fold back upon themselves appears to be a recurring theme for many T3SS secreted proteins. All of the needle monomer structures solved to date have a helixturnhelix structure that centers around a PXXP turn motif that is shared by almost all known needle protein monomers (Deane et al. 2006; Zhang et al. 2006). At the end of the needle resides a tip protein that possesses a prominent intramolecular coiled-coil that is not only required for the structure of the tip protein but for the interaction of the tip protein with the needle itself (Deane et al. 2006; Espina et al. 2006b). Within the IpaD tip protein subfamily, it appears that the N-terminal domain mimics the needle protein to chaperone the coiled-coil (Johnson et al. 2007). After exit from the needle, the domain is repositioned to allow the coiled-coil to dock onto the needle. In Shigella, the next secreted protein to localize at the needle tip is IpaB (Olive et al., in press), one of the two translocator proteins, which is also predicted to possess a coiled-coil motif (Johnson et al. 2007). Similarly, the other Shigella translocator protein, IpaC, is predicted to contain a coiled-coil that may be involved in proteinprotein interactions (Pallen et al. 1997). As a rule, disruption of these helical structures results in a loss of T3SS function (Kueltzo et al. 2003b; Picking et al. 2005; Espina et al. 2006b). Regions outside the helical core of these proteins appear to impart specific pathogen functions (Kueltzo et al. 2003b; Picking et al. 2005; Espina et al. 2006b; Johnson et al. 2007).
This study provides the first detailed biophysical characterization of a family of T3SA needle-associated proteins and builds on the recent crystal structures of three of the tip proteins. It is now clear that there are certain structural features that seem to generally apply to this group of proteins. The secondary structure analyses of these five T3SA needle tip proteins suggest that all of the T3SA needle tip proteins are highly
-helical and contain an intramolecular coiled-coil located within the C-terminal two-thirds of the protein that dictates the nature of the tip protein interaction with the needle tip. The independently folded N-terminal domain of IpaD and SipD is not clearly identifiable within all of tip proteins within the resolution of the approaches used here. The presence or absence of an independently folding N-terminal domain may be associated with biological functions, in addition to needle tip localization, that are unique to the individual proteins. The lack of multiple transitions, however, does not exclude the presence of distinct domains having similar thermal stabilities. Since it appears that IpaD and the other needle tip proteins are a structural component of the T3SA needle, it is noteworthy that a major feature of flagellin is the existence of a coiled-coil structure that contributes to flagellar filament polymerization. This may reflect a similarity in the mechanism by which the helixturnhelix region of the needle proteins mediates needle filament assembly (Deane et al. 2006). In this respect, the needle tip proteins may represent a short extension of the T3SA needle that is capable of sensing the environment to control the subsequent secretion of T3SS secretion substrates (Olive et al., in press). While speculative, this model for assembly of the external portion of the T3SA provides a basis upon which future investigation can be built.
| Materials and Methods |
|---|
|
|
|---|
Preparation of affinity-purified recombinant proteins
The sipD gene was subcloned from pwpsf4 (Picking et al. 2005) into pET15b by previously described methods (Harrington et al. 2003). The bipD gene was copied from B. pseudomallei chromosomal DNA by PCR using a 5'-primer containing GAGAGA, an NdeI restriction site, and the first 14 bases of the gene; and a 3'-primer containing GAGAGA, a BamHI site, and the last 14 bases of the gene. The resulting PCR fragment was digested with NdeI/BamHI and ligated into pET15b, and the ligated plasmid was transformed into E. coli NovaBlue. The N-terminal deletion mutants were made by copying the truncated gene from the plasmid containing the full-length gene using a T7 terminator primer as the 3'-primer and the following as the 5'-primers: sipD
1121 , GAGAGACATATGGCGCAGCCGAGAAC; bipD
1123 , GAGAGACATATGATCCAGCCGGACCCGA; lcrV
1146 , GAGAGACATATGCATGGTGATGCCCGTAG; pcrV
1127 , GAGAGACATATGAAGCGCAAGGCGCTGC. The resulting PCR products were digested with NdeI and BamHI or XhoI for sipD and ligated into pET15b, and the ligation products were transformed into E. coli NovaBlue.
The expression plasmids were transformed into E. coli Tuner (DE3) with the recombinant proteins purified as previously described using nickel chelation chromatography (Marquart et al. 1995), dialyzed against 10 mM Na2HPO4 (pH 7.0), 150 mM NaCl (PBS), and stored at 70°C. Protein concentrations were determined by measuring the absorbance at 280 nm using extinction coefficients based on the amino acid composition of each protein (Mach et al. 1992).
Far-UV circular dichroism spectroscopy
Far-UV CD spectra were collected in a Jasco J720 spectropolarimeter (Jasco, Inc.) as previously described (Ausar et al. 2005; Espina et al. 2006a) using a protein concentration of 0.1 mg/mL. Spectra were collected at 10°C in 0.1-cm path-length cuvettes using a resolution of 0.5 nm, 2-sec response time, and a scanning speed of 20 nm/min. Thermal unfolding was followed by monitoring the ellipticity at 222 nm from 10°C to 90°C. Data analysis was performed as previously described (Espina et al. 2006a).
FTIR spectroscopy
The secondary structure of the full-length proteins in solution was also assessed using Fourier transform infrared (FTIR) spectroscopy with an ABB Bomen FTIR MB series spectrometer (ABB Bomen). Samples of 1 mL of protein in D2O (1518 mg/mL) were placed onto an attenuated total reflectance (ATR) crystal equipped with an A.R.K. temperature controller (Spectra-Tech). Spectra were collected under dry air purge using a resolution of 4 cm1 and the co-addition of 256 interferograms. Data analysis was performed as described previously (Espina et al. 2006a).
UV absorbance spectroscopy
High-resolution absorbance spectra were collected as described (Kueltzo et al. 2003b; Ausar et al. 2005; Espina et al. 2006a) using a protein concentration of 0.1 mg/mL in a Hewlett-Packard 8453 UV-Visible spectrophotometer (Agilent). Spectra were analyzed between 200 nm and 400 nm with an experimental resolution of 1 nm over a temperature of 10°90°C at 2.5°C intervals. A 3-min equilibration time was used before collection of each spectrum. The optical density at 360 nm was simultaneously recorded as the measure of protein association/aggregation.
Intrinsic and extrinsic fluorescence spectroscopy
Tryptophan fluorescence and externally bound 8-anilino-1-naphthalene sulfonate (ANS) were monitored as previously described (Kueltzo et al. 2003a; Ausar et al. 2005; Espina et al. 2006a) using a PTI QuantaMaster spectrophotometer (Photon Technology International) equipped with a Peltier controlled cuvette holder. The protein concentration used was 0.1 mg/mL. A 1-cm path-length cuvette with Teflon cap was used in all experiments. Spectra were collected from 10°C to 90°C at 2.5°C intervals with a 3-min equilibration time at each temperature. The excitation wavelengths for Trp and ANS were set at 280 and 385 nm, respectively.
Differential scanning calorimetry (DSC)
Calorimetric experiments were performed as previously described (Espina et al. 2006a) using a protein concentration of 2 mg/mL with a MicroCal VP-DSC high-throughput capillary differential scanning calorimeter (Northampton). DSC thermograms were obtained from 10°C to 115°C at a scan rate of 1°C/min with a protein concentration of 2 mg/mL in PBS. Baseline correction was performed by subtracting a buffer thermogram obtained under identical conditions. The data were analyzed using MicroCal Origin 7.0 (Origin-Lab Corporation) assuming a non-two-state unfolding model (Sanchez-Ruiz 1992).
| Footnotes |
|---|
Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.062645007.
| Acknowledgments |
|---|
|
|
|---|
| References |
|---|
|
|
|---|
Ausar, S.F., Rexroad, J., Frolov, V.G., Look, J.L., Konar, N., and Middaugh, C.R. 2005. Analysis of the thermal and pH stability of human respiratory syncytial virus. Mol. Pharmacol. 2: 491499.[CrossRef][Medline]
Buttner, D. and Bonas, U. 2006. Who comes first? How plant pathogenic bacteria orchestrate type III secretion. Curr. Opin. Microbiol. 9: 193200.[CrossRef][Medline]
Cordes, F.S., Komoriya, K., Larquet, E., Yang, S., Egelman, E.H., Blocker, A., and Lea, S.M. 2003. Helical structure of the needle of the type III secretion system of Shigella flexneri . J. Biol. Chem. 278: 1710317107.
Cossart, P. and Sansonetti, P.J. 2004. Bacterial invasion: The paradigms of enteroinvasive pathogens. Science 304: 242248.
Deane, J.E., Roversi, P., Cordes, F.S., Johnson, S., Kenjale, R., Daniell, S., Booy, F., Picking, W.D., Picking, W.L., Blocker, A.J., et al. 2006. Molecular model of a type III secretion system needle: Implications for host-cell sensing. Proc. Natl. Acad. Sci. 103: 1252912533.
Derewenda, U., Mateja, A., Devedjiev, Y., Routzahn, K.M., Evdokimov, A.G., Derewenda, Z.S., and Waugh, D.S. 2004. The structure of Yersinia pestis V-antigen, an essential virulence factor and mediator of immunity against plague. Structure 12: 301306.[Medline]
Erskine, P.T., Knight, M.J., Ruaux, A., Mikolajek, H., Sang, N.W., Withers, J., Gill, R., Wood, S.P., Wood, M., Fox, G.C., et al. 2006. High resolution structure of BipD: An invasion protein associated with the Type III secretion system of Burkholderia pseudomallei . J. Mol. Biol. 363: 125136.[CrossRef][Medline]
Espina, M., Ausar, S.F., Middaugh, C.R., Picking, W.D., and Picking, W.L. 2006a. Spectroscopic and calorimetric analyses of invasion plasmid antigen D (IpaD) from Shigella flexneri reveal the presence of two structural domains. Biochemistry 45: 92199227.[CrossRef][Medline]
Espina, M., Olive, A.J., Kenjale, R., Moore, D.S., Ausar, S.F., Kaminski, R.W., Oaks, E.V., Middaugh, C.R., Picking, W.D., and Picking, W.L. 2006b. IpaD localizes to the tip of the Type III secretion system needle of Shigella flexneri . Infect. Immun. 74: 43914400.
Fields, K.A., Nilles, M.L., Cowan, C., and Straley, S.C. 1999. Virulence role of V antigen of Yersinia pestis at the bacterial surface. Infect. Immun. 67: 53955408.
Harrington, A.T., Hearn, P.D., Picking, W.L., Barker, J.R., Wessel, A., and Picking, W.D. 2003. Structural characterization of the N terminus of IpaC from Shigella flexneri . Infect. Immun. 71: 12551264.
He, S.Y., Nomura, K., and Whittam, T.S. 2004. Type III protein secretion mechanism in mammalian and plant pathogens. Biochim. Biophys. Acta 1694: 181206.[Medline]
Heimburg, T., Schuenemann, J., Weber, K., and Geisler, N. 1996. Specific recognition of coiled coils by infrared spectroscopy: Analysis of the three structural domains of type III intermediate filament proteins. Biochemistry 35: 13751382.[CrossRef][Medline]
Heimburg, T., Schunemann, J., Weber, K., and Geisler, N. 1999. FTIR-Spectroscopy of multistranded coiled coil proteins. Biochemistry 38: 1272712734.[CrossRef][Medline]
Johnson, S., Roversi, P., Espina, M., Olive, A., Deane, J.E., Birket, S., Field, T., Picking, W.D., Blocker, A.J., Galyov, E.E., et al. 2006. Self-chaperoning of the type III secretion system needle tip proteins IpaD and BipD. J. Biol. Chem. 282: 40354044.
Kaniga, K., Trollinger, D., and Galan, J.E. 1995. Identification of two targets of the type III protein secretion system encoded by the inv and spa loci of Salmonella typhimurium that have homology to the Shigella IpaD and IpaA proteins. J. Bacteriol. 177: 70787085.
Kueltzo, L.A., Ersoy, B., Ralston, J.P., and Middaugh, C.R. 2003a. Derivative absorbance spectroscopy and protein phase diagrams as tools for comprehensive protein characterization: A bGCSF case study. J. Pharm. Sci. 92: 18051820.[CrossRef][Medline]
Kueltzo, L.A., Osiecki, J., Barker, J., Picking, W.L., Ersoy, B., Picking, W.D., and Middaugh, C.R. 2003b. Structure-function analysis of invasion plasmid antigen C (IpaC) from Shigella flexneri . J. Biol. Chem. 278: 27922798.
Lakowicz, J.R. 1983. Principles of fluorescence spectroscopy. Plenum Press, New York.
Lawton, D.G., Longstaff, C., Wallace, B.A., Hill, J., Leary, S.E., Titball, R.W., and Brown, K.A. 2002. Interactions of the type III secretion pathway proteins LcrV and LcrG from Yersinia pestis are mediated by coiled-coil domains. J. Biol. Chem. 277: 3871438722.
Lobley, A., Whitmore, L., and Wallace, B.A. 2002. DICHROWEB: An interactive website for the analysis of protein secondary structure from circular dichroism spectra. Bioinformatics 18: 211212.
Mach, H. and Middaugh, C.R. 1994. Simultaneous monitoring of the environment of tryptophan, tyrosine, and phenylalanine residues in proteins by near-ultraviolet second-derivative spectroscopy. Anal. Biochem. 222: 323331.[CrossRef][Medline]
Mach, H., Middaugh, C.R., and Lewis, R.V. 1992. Statistical determination of the average values of the extinction coefficients of tryptophan and tyrosine in native proteins. Anal. Biochem. 200: 7480.[CrossRef][Medline]
Manavalan, P. and Johnson Jr, W.C. 1987. Variable selection method improves the prediction of protein secondary structure from circular dichroism spectra. Anal. Biochem. 167: 7685.[CrossRef][Medline]
Marenne, M.N., Journet, L., Mota, L.J., and Cornelis, G.R. 2003. Genetic analysis of the formation of the Ysc-Yop translocation pore in macrophages by Yersinia enterocolitica: Role of LcrV, YscF and YopN. Microb. Pathog. 35: 243258.[CrossRef][Medline]
Marquart, M.E., Picking, W.L., and Picking, W.D. 1995. Structural analysis of invasion plasmid antigen D (IpaD) from Shigella flexneri . Biochem. Biophys. Res. Commun. 214: 963970.[CrossRef][Medline]
Mueller, C.A., Broz, P., Muller, S.A., Ringler, P., Erne-Brand, F., Sorg, I., Kuhn, M., Engel, A., and Cornelis, G.R. 2005. The V-antigen of Yersinia forms a distinct structure at the tip of injectisome needles. Science 310: 674676.
Murayama, K. and Tomida, M. 2004. Heat-induced secondary structure and conformation change of bovine serum albumin investigated by Fourier transform infrared spectroscopy. Biochemistry 43: 1152611532.[CrossRef][Medline]
Nanao, M., Ricard-Blum, S., Di Guilmi, A.M., Lemaire, D., Lascoux, D., Chabert, J., Attree, I., and Dessen, A. 2003. Type III secretion proteins PcrV and PcrG from Pseudomonas aeruginosa form a 1:1 complex through high affinity interactions. BMC Microbiol. 3: 21.[CrossRef][Medline]
Olive, A.J., Kenjale, R., Espina, M., Moore, D.S., Picking, W.L., and Picking, W.D. 2007. Bile salts stimulate recruitment of IpaB to the Shigella surface where it co-localizes with IpaD at the tip of the type III secretion needle. Infect. Immun. (in press).
Pallen, M.J., Dougan, G., and Frankel, G. 1997. Coiled-coil domains in proteins secreted by type III secretion systems. Mol. Microbiol. 25: 423425.[CrossRef][Medline]
Picking, W.L., Nishioka, H., Hearn, P.D., Baxter, M.A., Harrington, A.T., Blocker, A., and Picking, W.D. 2005. IpaD of Shigella flexneri is independently required for regulation of Ipa protein secretion and efficient insertion of IpaB and IpaC into host membranes. Infect. Immun. 73: 14321440.
Rosen, C.G. and Weber, G. 1969. Dimer formation from 1-amino-8-naphthalenesulfonate catalyzed by bovine serum albumin. A new fluorescent molecule with exceptional binding properties. Biochemistry 8: 39153920.[CrossRef][Medline]
Sanchez-Ruiz, J.M. 1992. Theoretical analysis of Lumry-Eyring models in differential scanning calorimetry. Biophys. J. 61: 921935.
Stevens, M.P., Haque, A., Atkins, T., Hill, J., Wood, M.W., Easton, A., Nelson, M., Underwood-Fowler, C., Titball, R.W., Bancroft, G.J., et al. 2004. Attenuated virulence and protective efficacy of a Burkholderia pseudomallei bsa type III secretion mutant in murine models of melioidosis. Microbiol. 150: 26692676.
Whitmore, L. and Wallace, B.A. 2004. DICHROWEB: An online server for protein secondary structure analyses from circular dichroism spectroscopic data. Nucleic Acids Res. 32: W668W673.
Yip, C.K. and Strynadka, N.C. 2006. New structural insights into the bacterial type III secretion system. Trends Biochem. Sci. 31: 223230.[CrossRef][Medline]
Zhang, L., Wang, Y., Picking, W.L., Picking, W.D., and De Guzman, R.N. 2006. Solution structure of monomeric BsaL, the type III secretion needle protein of Burkholderia pseudomallei . J. Mol. Biol. 359: 322330.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
G. Caroline, F. Eric, Y.-S. T. Bohn, E. Sylvie, and I. Attree Oligomerization of PcrV and LcrV, Protective Antigens of Pseudomonas aeruginosa and Yersinia pestis J. Biol. Chem., August 29, 2008; 283(35): 23940 - 23949. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Stensrud, P. R. Adam, C. D. La Mar, A. J. Olive, G. H. Lushington, R. Sudharsan, N. L. Shelton, R. S. Givens, W. L. Picking, and W. D. Picking Deoxycholate Interacts with IpaD of Shigella flexneri in Inducing the Recruitment of IpaB to the Type III Secretion Apparatus Needle Tip J. Biol. Chem., July 4, 2008; 283(27): 18646 - 18654. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cisz, P.-C. Lee, and A. Rietsch ExoS Controls the Cell Contact-Mediated Switch to Effector Secretion in Pseudomonas aeruginosa J. Bacteriol., April 15, 2008; 190(8): 2726 - 2738. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, Y. Wang, A. J. Olive, N. D. Smith, W. D. Picking, R. N. De Guzman, and W. L. Picking Identification of the MxiH Needle Protein Residues Responsible for Anchoring Invasion Plasmid Antigen D to the Type III Secretion Needle Tip J. Biol. Chem., November 2, 2007; 282(44): 32144 - 32151. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||