| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 VTT Technical Research Centre of Finland, Espoo FIN-02044 VTT, Finland
2 Laboratory of Organic Chemistry, Helsinki University of Technology, FIN-02015 TKK, Finland
(RECEIVED March 1, 2007; FINAL REVISION April 12, 2007; ACCEPTED April 26, 2007)
 |
Abstract |
|---|
 TOP Abstract IntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
Keywords: protein cleavage; His tag; artificial protease; protein stability; Co(II); Cu(II)
|
Introduction |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
An easy way of cleaving proteins specifically at desired positions would be useful in many cases. It would be desirable that protein engineering could be used to insert the cleavage sequence, and that the cleavage would not be dependent on large molecules that could be sterically hindered to access the cleavage position. Such a cleavage system would allow the removal of purification or expression enhancement tags but could also be used as a tool for several other types of applications, for example, to inactivate or activate proteins or to study structure–function relations. Inactivation could be achieved by cleaving of a peptide sequence at a functional position, and activation by removing an added protein domain that blocked an enzyme from functioning.
Metal ion-dependent cleavage of proteins (and DNA) shows promise for the above-mentioned applications. The use of chelates of different metals has been widely studied for this purpose (Hegg and Burstyn 1998; Polzin and Burstyn 2001; Grant and Kassai 2006). Many complexes of metals have been studied that give significantly increased cleavage over the background reaction. The strategy typically relies on various chelates of metal ions of metals such as Ce, Co, Cu, Mo, Ni, Pd, Pt, Zn, and Zr, and can depend on either oxidative cleavage or hydrolysis. Several strategies depend on careful analysis of coordination chemistry and mimicking natural metalloproteases. Only a few such synthetic systems have, however, found practical applications in biochemical research. One successful example is the use of Fe2+ in combination with chelating molecules (Rana and Meares 1991b; Ermacora et al. 1992; Platis et al. 1993). The system is based on tethering the Fe2+ to a protein by a dual-function molecule that on the one hand binds Fe2+ by an EDTA-like chelate, and on the other hand has a reactive group for binding to proteins, for example, through coupling with free sulfhydryl groups. An oxidative cleavage reaction occurs when ascorbate and hydrogen peroxide is added. In the reaction the peptide backbone is cleaved, but only at positions very close to the tethered Fe2+. In this way, the reaction can be used to probe structure–function relations in proteins. The reaction is hydrolytic and proceeds through activated oxygen species coordinated by Fe2+ and requiring the presence of ascorbate and hydrogen peroxide (Rana and Meares 1991a).
In this work, we show that chemical cleavage of a peptide sequence can be obtained at a predetermined site. This cleavage does not depend on separate chelating molecules but relies on the use of free metal salts. For chelating the metal ions, His residues were engineered into the recombinant proteins, because the imidazole group of His is known to coordinate efficiently with soft (or borderline) metal ions (Ueda et al. 2003). Typically six or more His residues were used as a binding site for the metal ions. As with the Fe2+ chelates described above, the reaction was driven by the addition of ascorbate and optionally hydrogen peroxide. However, in this setup, addition of Fe2+ did not cause any reaction, but very clear reactions were obtained by the addition of Cu2+ or Co2+.
|
Results |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
|
|
|
|
MBP-H6-AVI was subjected to a similar procedure, giving a mass for the MBP of 41,988 m/z. However, streptavidin could not be isolated and analyzed, probably because streptavidin forms tetramers where intact fusion protein is mixed with cleaved streptavidin incorporated into heterotetramers under nondenaturing conditions.
Comparison of different metal ions
The effect of using different metal ions was compared by studying the cleavage of fusion proteins in the presence of FeCl3, CoCl2, NiCl2, CuCl2, and ZnCl2. These metals are the group 8–12 transition metals from period 4. In Figure 4, the cleavage of the fusion proteins MBP-H6-ABP or MBP-G6-ABP is shown. The reactions were performed in 50 mM ammonium carbonate buffer at pH 7.5 with 20 mM ascorbate and 1.5 mM hydrogen peroxide at 30°C for 15 min. The concentration of metal salts was either 1 µM, 3 µM, 6 µM, or 10 µM corresponding to 0.3x, 1x, 2x, and 3.3x molar ratios of metal ion to protein. With FeCl3, NiCl2, and ZnCl2 no effect of the treatment can be seen. Some effect can be seen with CoCl2, and clearly the largest effect is with CuCl2 (lanes 2–5). The control protein containing no His residues in the linker is not affected by the treatment (lanes 7–10), except for those with the highest CuCl2 concentration where the band seems to fade (lane 10). The excess of CuCl2 in these experiments seems to cause a nonspecific degradation. The effect of different metal ions was the same regardless of fusion protein (data not shown).
|
|
|
The effect of the reaction temperature on peptide cleavage was investigated by incubating the fusion proteins in the presence of CoCl2 or CuCl2, ascorbate, and hydrogen peroxide. The effect of temperature was very small although the reaction was slightly slower at low temperatures than in higher reaction temperatures. Interestingly, high temperatures and CuCl2 resulted in some additional high-molecular-weight bands, which could be a result of a polymerization reaction with the protein.
Effect of ascorbate and hydrogen peroxide concentrations
The effect of ascorbate and hydrogen peroxide on peptide cleavage was studied by varying their concentrations. In Figure 7, the results for cleaving MBP-H8-AVI in the presence of one molar equivalent of CuCl2 (60 min, 21°C) are shown. If neither ascorbate nor hydrogen peroxide was present, no reaction occurred. If only hydrogen peroxide but not ascorbate was present, no reaction occurred (Fig. 7A), and if ascorbate is present but not hydrogen peroxide, only a very slight reaction occurred (Fig. 7B). Already at concentrations as low as 1 mM ascorbate in the presence of 0.7 mM hydrogen peroxide, there was a clear reaction (Fig. 7A). The reaction was not significantly affected by increasing the concentration (up to 41 mM is shown in Fig. 7A). In Figure 7B, the effect of increasing the hydrogen peroxide concentration is shown. With ascorbate present at 9 mM, there was a clear increase in reaction efficiency with higher concentrations of hydrogen peroxide, although a minor reaction was observable even without hydrogen peroxide.
|
In typical reactions, some intact fusion protein always remained. A complete cleavage of the fusion protein was not possible even by increasing the amount of metal salt or ascorbate and hydrogen peroxide. To get a more complete reaction we tested the reaction in cycles with fresh reagent and repeating the incubation several times. In one example, six Eppendorf tubes with 1.6 µM MBP-H10-AVI were incubated with a 10 molar equivalent of CoCl2 and 2.3 mM ascorbate at room temperature. After a 30-min incubation time, the reaction in one of the tubes was stopped with an excess of EDTA and a new dose of cobalt and ascorbate was added to the rest of the tubes. This procedure was repeated another five times so that the final cobalt concentration in the last tube was 60 times the concentration of the fusion protein and the ascorbate concentration 13.7 mM. The samples were then analyzed by SDS-PAGE (data not shown). In this experiment, the band corresponding to the uncleaved fusion protein and the product bands increased for each cycle. However, even in the last tube a clear band corresponding to the uncleaved protein could be seen. Thus, the cleavage efficiency can be improved up to a certain degree by repeated additions of metal ions and ascorbate.
Effect of the nature of the linker
The role of the nature of the linker was studied by allowing proteins with different numbers of His residues to react under identical conditions (Fig. 8). Cleavage reactions were performed on MBP-Hn-AVI fusion proteins, where the subscript n indicates linkers containing 2, 4, 6, 8, or 10 His residues. The reactions were performed with 10 molar equivalents of CoCl2 to protein (60 min, 21°C). The results showed that the length of the linker clearly affects the cleavage result. Some minor cleavage products could already be observed if the linker of the fusion protein contained two His residues (MBP-H2-AVI). There was a slight but clear increase in reactivity with an increasing number of His residues. No cleavage occurred in the linker without His residues (MBP-H0-AVI) as shown in Figure 1, lane 3, or if the His in the linker were replaced by Gly (data not shown). Interestingly, inserting other amino acids in between His-residues (MBP-HX6-AVI) (see Table 1) resulted in a fusion protein that was cleaved as efficiently as the one with six consecutive His-residues.
|
|
Discussion |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
The strategy for constructing metal binding sites was to add His residues into the linker region. We first demonstrated that cleavage of the connecting linker occurs, and that it is dependent on (1) the number of His residues, (2) the presence and nature of metal ions, and (3) the presence of redox agents, such as ascorbate and hydrogen peroxide. The effects of temperature, buffer composition, and pH on the kinetics of the reaction were then studied.
The typical cleavage reaction can be seen (Fig. 1) when a fusion protein with MBP linked to streptavidin by a linker that contains 10 consecutive His residues was mixed with a 10x molar excess of Co2+ and low concentrations of ascorbate and hydrogen peroxide for 60 min at room temperature. Adding EDTA was an efficient way to stop or inhibit the reaction. Treating a fusion protein without His residues in the linker or with Gly instead of His in the same way does not result in any detectable amount of cleavage. Sometimes a slight cleavage of His containing linkers could be seen even without adding metal. This was probably due to the presence of traces of metal ions from the purification steps or elsewhere. However, such cleavage could be inhibited by the addition of EDTA.
Having established the occurrence of the cleavage reaction, we proceeded to look more closely at parameters affecting reaction rates. The nature and amount of metal ion, the character of the linker, and reducing agents all affected the rate of reaction, as did temperature and pH but to a lesser extent.
There was a clear requirement for metal ions for the cleavage reactions to occur. We found that Cu2+ and Co2+ ions were the most reactive, with Cu2+ clearly causing a more extensive reaction. It is remarkable that only one molar equivalent of Cu2+ caused extensive cleavage of the fusion protein. For Co2+ a 10x excess was needed for an optimal yield (Fig. 5). A clear difference between the effect of Cu2+ and Co2+ ions was also that an excess of Cu2+ ions caused all the protein bands to decrease in intensity, indicating some kind of overall protein degradation. This overall degradation was not observed with Co2+ ions.
After a typical cleavage reaction some fusion protein typically remained uncleaved. Because each fusion protein potentially contains several potential binding sites within the His residues, it could be thought that an uneven distribution of metal ions between the protein molecules left some molecules without metal and hence remained intact. Surprisingly, however, increasing the amount of metal did not result in a complete cleavage, but some intact protein always remained. Repeated incubations with fresh reagents did cause the reaction to proceed, but a total cleavage of the initial material was difficult to achieve.
Salts of other metals tested, Zn, Ni, and Fe, did not cause any measurable cleavage of the proteins under the conditions tested. Fe is known to cause oxidative cleavage of proteins (see below) (Grant and Kassai 2006), but being a hard ion, it does not have a high affinity to His residues. This supports the idea that a close proximity of the metal and protein is needed for cleavage to occur under the conditions described here.
The number of His residues in the linker region also clearly affected the cleavage reaction. Already two adjacent residues were sufficient for a noticeable reaction to occur, but increasing the number of His residues significantly increased the efficiency (Fig. 8). However, adding more than six residues only slightly improved the cleavage, as was demonstrated with fusion proteins containing eight or ten His residues. Linkers containing six His residues, but with one Gly or Ser in between each His residue, also behaved very similarly as the linker with six consecutive His residues, showing that the His residues do not have to be consecutive. The effect of linker length and composition was the same for cleavage with both CoCl2 and CuCl2. In this work we did not systematically study how side chains other than His would promote cleavage. However, it is likely that other types of side chains such as Cys or Trp also could have functioned similarly. The use of Cys was avoided because the reactivity of free sulfhydryl groups can cause experimental problems such as aggregation in protein production.
The cleavage reaction was very fast and occurred efficiently at a temperature of 4°C with only a few minutes of incubation. The pH dependence showed an optimum around 7–8. The presence of ascorbate was shown to be essential for cleavage to occur. Hydrogen peroxide increased the effect even at low concentration but was not essential. The CoCl2-mediated reaction proceeded even without hydrogen peroxide, having a strict requirement only for ascorbate.
There is a large interest in different metal-mediated cleavage reactions, and there are many reports on the subject (Grant and Kassai 2006). However, several findings suggest that the underlying mechanisms differ significantly. A work that is conceptually close to the current one was described by Humphreys et al. (1999, 2000). In that work it was found that proteins containing the sequence DKTH could be cleaved in the presence of Cu2+, and to a small extent by Ni2+. However, the mechanisms of cleavage seem to be very different. Cleavage occurred only at pH values over 7, and efficient cleavage only above pH 8. The temperature required was over 50°C, and 50% cleavage was obtained only after over 10 h. Most significantly, neither ascorbate nor hydrogen peroxide affected the cleavage rate. In view of the present work, this result is surprising. One possible reason for this difference is the affinity for the binding sequences for metals are different. In our work, longer sequences of His residues were used, giving a stronger affinity. Whereas only one molar equivalent of Cu was needed in the present work, several 100-fold was used by Humphreys et al. (1999, 2000). Results similar to those of Humphreys et al. (1999, 2000) have been obtained in another work (Allen and Campbell 1996). There it was noted that Ser-His and Thr-His are cleaved slowly by Cu2+ with a half-life of several hours at over 60°C and pH 8. Also in this work cleavage did not depend on added ascorbate.
Much work has been done on metal-mediated cleavage reactions that involve tethering the metal ion by synthetic chelating molecules (Rana and Meares 1991b; Ermacora et al. 1992). The metal tether was constructed so that it had one functionality binding a metal ion, typically a modified EDTA-based chelator used to bind Fe3+ ions. Another part of the tether was functionalized to bind to proteins through Cys residues. Using this type of molecule, it was possible to probe protein–protein interactions because the iron-mediated cleavage only occurred at very short range, and it could be concluded that the site of cleavage must be near the bound Fe ion. Also this iron-mediated cleavage required the presence of ascorbate and hydrogen peroxide. The reaction occurred quickly at pH 7. The Fe–chelate cleavage and the reaction described here are similar in that they both depend on ascorbate and hydrogen peroxide. In our work, the Fe ions did not bind to the proteins and therefore no effect of Fe ions was observed.
In another study by Kim et al. (1985) it was found that iron caused cleavage of some proteins without chelate-mediated localization. In that work it was found that a yeast–protein was degraded in the presence of Fe3+ and dithiothreitol (DTT), but the degradation was inhibited in the presence of EDTA. Since some reaction could also be detected in the presence of copper and ascorbate, and the reaction occurred at 30°C, pH 7, it seems that its underlying mechanism is similar to the one occurring in the current work. However, the reaction times required were much longer and the metal ion concentration higher, indicating that the engineered sites in the current work were able to bind the metal ions more efficiently.
Although cleavage reactions involving chelates of Fe3+/Fe2+, Ni2+, and Cu2+ have been described in the literature, there are not many reports on the use of cobalt ions. Chelates of cobalt ions have been used to achieve hydrolysis of some peptides and proteins (Kumar et al. 2000; Jeon et al. 2003; Jitsukawa et al. 2006). The reactions were very sensitive to the Co3+ chelate structure and did not depend on the use of ascorbate or hydrogen peroxide. The reaction rates were measured in tens of hours and required elevated temperatures and pH. The chelate concentrations used were typically 100-fold higher than the protein concentrations. In these reports, the cleavage sites in the peptide chains were not purposefully designed or engineered.
It is clear from the experimental data that the reaction depends on a close binding of the metal ion and the peptide chain. In principle, two types of reaction could be possible: either a radical reaction through reactive oxygen species or a hydrolysis type of reaction (Grant and Kassai 2006). The dependence of ascorbate and hydrogen peroxide indicates that a radical reaction is responsible for the observed cleavage. Bateman Jr. et al. (1985) suggested that hydroxyl radicals can cleave peptide bonds by a mechanism initiated by the abstraction of the hydrogen of the 
-carbon in the peptide backbone.
Hydroxyl radicals can be produced by a Fenton-type reaction as described in Equations 1–3.
|
|
|
|
|
|
The reducing agent ascorbate leads to a cycle where Fe3+ is reduced back to Fe2+. This reaction is typically described for Fe, but other metals such as Cu and Co have also been reported to function in analogous ways but with different specificities and rates (Walling 1975; Stubbe and Kozarich 1987; Tung and Sawyer 1990; Sobkowiak et al. 1993; Sawyer et al. 1996). The Fe–chelate-mediated cleavage of peptide chains (Rana and Meares 1991b; Ermacora et al. 1992) resembles the one described here, but for that reaction it was shown that Fe ions coordinate the reactive oxygen species (Rana and Meares 1991a). We noted a clear difference between the Co2+- and Cu2+-mediated reactions, which could either be due to a different rate of activated oxygen radical production or more direct involvement of intermediates containing metal ions. However, we do not have data that would give a clear insight in the mechanism of the reaction. The mass spectroscopy (Fig. 3) shows that cleavage seems to happen preferentially at a specific His residue although it can occur at any of the His residues. The failure to achieve Edman sequencing from the C-terminal fragments indicates that the N-terminal residue is not in an intact amine.
The efficient and easy cleavage of proteins at specific sites can be of great potential in many applications and fundamental studies of proteins. Uses can be found, for example, in removal of purification tags, or for the specific activation or inactivation of proteins in controllable circumstances. The work described here has much in common with earlier work with metal ion-mediated cleavage of proteins but shows some clearly distinct new findings. The cleavage site can easily be engineered into a protein, the reaction needs only added metal salts, it occurs quickly at a broad pH range near neutral and at low temperature. Cu ions have been used in studies having some resemblance to the current one, but the finding that Co ions bound to proteins can cause a cleavage reaction is novel. The current work can also be of practical importance for protein purification using His tags, a method that is widely used. The His-tagged recombinant proteins (containing typically six His residues) are often purified with Cu ion-loaded chromatographic resins. Since only very low concentrations of Cu ions were needed for cleavage there is a risk that unexpected cleavage of the target protein could occur at any stage of the protein processing.
For practical use of the described reaction, it seems that Co-mediated cleavage has a larger potential since an excess of Cu ions could cause an overall degradation of the protein. We still have very little information on the exact mechanisms of the reaction. Future studies addressing the mechanism could help to develop the cleavage reaction into a practical tool in biochemistry and molecular biology.
|
Materials and Methods |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
To add the sequence encoding the linker GSPTGASTHHHHHHGSPTGAST in between MBP and ABP in pLink1, synthetic oligos were kinased with T4 polynucleotide kinase, annealed, and ligated directly into SacI and EcoRI cut pLink1. This generated pLink2. The sequences of all linker oligos are shown in the Supplemental data. Identically, a plasmid expressing MBP-GSPTGASTGGGGGGGSPTGAST-ABP was generated by a pair of oligos encoding GSPTGASTGGGGGGGSPTGAST. This generated pLink3. For expression of the cytosolic fragment of Sso2 (Sso2-ma, amino acids 1–270) (Aalto et al. 1993) as a MBP fusion separated by a linker, Sso2-ma fragment was amplified by PCR with the oligos GCATTGAATTCATGAGCAACGCTAATCCTTATGA and GCATTAAGCTTTTATCATCTTATTTTGTTTTTTCTTGC using a genomic fragment of Sso2 as the template followed by ligation into pCR2.1-TOPO. SSO2-ma was then cloned as an EcoRI/HindIII fragment into EcoRI/HindIII cut pLink2 to replace streptavidin with Sso2-ma and generate pLink14 for expression of MBP-GSPTGASTHHHHHHGSPTGAST-Sso2.
For construction of a vector for expression of MBP-GSPTGASTHHHHHHGSPTGAST-AVI in E. coli, a DNA fragment of the Streptomyces avidinii gene for amino acids 25–183 of streptavidin (GeneBank X03591) was amplified by PCR by using the vector pK501–1 (Oker-Blom et al. 1996) as a template. The streptavidin (AVI) specific 5' oligo was GCATTGAATTCGACCCCTCCAAGGACTCGAAGG and the 3' oligo was GCATTAAGCTTCTACTGCTGAACGGCGTCGAGC. The PCR fragment was TA-ligated to the pCR2.1-TOPO vector (Invitrogen) and subsequently after cutting with EcoRI and HindIII enzymes ligated into EcoRI and HindIII cut pLink2 vector to yield pLink6. To generate pLink7 vector expressing MBP-GSPTGASTGSTGPSGSPTGAST-AVI, the corresponding oligos were kinased, annealed, and ligated into SacI and EcoRI cut pLink6. Identically, pLink8 expressing MBP-GSPTGASTHHHHGSPTGAST-AVI was generated by linker oligo ligation into SacI and EcoRI cut pLink6. The pLink10 expressing MBP-GSPTGASTHHGSPTGAST-AVI, pLink12 expressing MBP-GSPTGASTHHHHHHHHGSPTGAST-AVI, and pLink13 expressing MBP-GSPTGASTHSHAHGHAHSHGSPTGAST-AVI were generated identically to pLink8.
Production and purification of fusion proteins
The purification of MBP fusion proteins was carried out using the pMAL Protein Fusion and Purification System (New England Biolabs Inc.); this was used in the production and purification of the fusion proteins in Table 1. XL1 Blue E. coli cells transformed with the vectors encoding the various fusion proteins were grown in a rotary shaker (200 rpm) in LB medium with 0.1 mg/mL ampicillin at 37°C. IPTG was added to a final concentration of 0.3 mM when the absorbance at 600 nm was 0.5, and the incubation was continued for 3 h. After centrifugation, 5000 rpm, 15 min at 4°C, the cells were resuspended in 31.5 mL of MAL buffer (50 mM Tric-Cl at pH 7.5, 0.2 M NaCl, and 1mM EDTA at pH 8) and broken by sonication (Soniprep 150 sonicator, MSE Scientific Instruments) 3 x 15 sec on ice. The cell debris was removed by centrifugation at 9000g for 20 min at 4°C. The fusion proteins were purified by affinity chromatography on a 5-mL amylose column (New England Biolabs Inc.). The column was equilibrated with MAL buffer, and the protein was eluted with 10 mM maltose in MAL buffer. The fusion protein containing fractions was pooled, and the buffer was changed by using Econo-Pac 10 DG columns (Bio-Rad Laboratories) to 50 mM ammonium acetate at pH 7.5. The buffer exchange was repeated in Vivaspin concentrators (10,000 MWCO, PES, Vivascience Ltd.). The purity of the fusion proteins was verified by SDS-PAGE and Coomassie staining.
Cleavage of fusion proteins by using metal ions
Unless otherwise stated, a general cleavage reaction was performed by mixing 3.3 µM fusion protein with 3.3–33 µM metal salt (corresponding to 1–10 molar equivalents), typically in 10 mM ammonium acetate at pH 7.5 or water. The metal salts used were FeCl3, CoCl2, MnCl2, ZnCl2, CuCl2, or CuSO4. The protein solution was mixed and incubated for 2 min at room temperature. All metal ions used were from 10x stocks dissolved in MilliQ-purified water (18.2 M
cm resistivity). In a separate tube, freshly prepared ascorbate adjusted to neutral pH with Na2CO3 was mixed with hydrogen peroxide just before use. The cleavage reaction was initiated by adding the mixed ascorbate and hydrogen peroxide to give final concentrations of 4.6 mM and 0.35 mM, respectively (or as stated). The reaction volume was typically 35 µL in a 1.5-mL Eppendorf tube, and the cleavage reaction was typically carried out for 60 min at room temperature in darkness. The reaction was quenched by adding a 10,000-fold molar excess of EDTA at pH 7.5. For SDS-PAGE, the quenched reaction solutions were heated for 5 min at 95°C together with SDS-PAGE loading buffer containing 
-mercaptoethanol: Electrophoresis was typically performed using Tris-HCl 10%–20% SDS-polyacrylamide gels (Bio-Rad). The protein bands were visualized by staining the gels with Coomassie brilliant blue (Amersham Pharmacia Biotech) for 60 min, after which the gels were destained before they were scanned and dried between cellulose membranes for storage.
Western blot analysis
For Western blot analysis, proteins were separated by SDS-PAGE and transferred to a nitrocellulose filter by electroblotting. The filter was blocked with 2% skim milk powder in buffer [10 mM Tris-HCl at pH 8, 150 mM NaCl, and 0.05% (v/v) Tween-20]. The primary antibodies used were anti-MBP antiserum (New England Biolabs) or anti-Sso2 antibody (Jäntti et al. 1994), both diluted 1:10000 in TBST buffer, and as a secondary antibody, goat anti-rabbit IgG (H + L) coupled to alkaline phosphatase (Bio-Rad) diluted 1:1000 was used.
Size exclusion chromatography
To separate the protein fragments produced in the cleavage reaction with fusion protein, size exclusion chromatography on a Superdex 200 HR 10/30 column (Amersham Pharmacia Biotech) was performed. The buffers used were 0.2 M NaCl in 50 mM acetate buffer at pH 5.0. Proteins from a Gel Filtration Calibration Kit (Amersham Pharmacia Biotech) were used as standards.
Mass analysis and N-terminal sequencing
The mass analyses were performed on MALDI-TOF (Matrix-Assisted Laser Desoption-Ionization Time-of-Flight) (Autoflex II, Bruker Daltonics). A small aliquot of protein sample was put on the sample plate and sinapic acid were added as the matrix. Ionization and data collection were performed by standard procedures. N-terminal sequencing was performed by Edman degradation on a Procise 494A sequencer (Applied Biosystems).
|
Electronic supplementary material |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
|
Footnotes |
|---|
Supplemental material: www.proteinscience.org
Reprint requests: to Markus B. Linder, VTT, Technical Research Centre of Finland, Tietotie 2, Espoo FIN-02044 VTT, Finland; e-mail: markus.linder{at}vtt.fi; fax: 358-20-7227071.
Article published online ahead of print. Article and publication date are at http://www.proteinscience.org/cgi/doi/10.1110/ps.072846407.
|
Acknowledgments |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
|
References |
|---|
|
TOPAbstractIntroductionResultsDiscussionMaterials and MethodsElectronic supplementary...AcknowledgmentsReferences |
|---|
Allen, G. and Campbell, R. 1996. Specific cleavage of histidine-containing peptides by copper(II). Int. J. Pept. Protein Res. 48: 265–273.[Medline]
Arnau, J., Lauritzen, C., Petersen, G.E., and Pedersen, J. 2006. Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins. Protein Expr. Purif. 48: 1–13.[CrossRef][Medline]
Bateman Jr, R., Youngblood, W., Busby Jr, W., and Kizer, J. 1985. Nonenzymatic peptide -amidation. Implications for a novel enzyme mechanism. J. Biol. Chem. 260: 9088–9091.
Ermacora, M., Delfino, J., Cuenoud, B., Schepartz, A., and Fox, R. 1992. Conformation-dependent cleavage of staphylococcal nuclease with a disulfide-linked iron chelate. Proc. Natl. Acad. Sci. 89: 6383–6387.
Grant, K.B. and Kassai, M. 2006. Major advances in the hydrolysis of peptides and proteins by metal ions and complexes. Curr. Org. Chem. 10: 1035–1049.[CrossRef]
Hegg, E.L. and Burstyn, J.N. 1998. Toward the development of metal based synthetic nucleases and peptidases: A rationale and progress report in applying the principles of coordination chemistry. Coord. Chem. Rev. 173: 133–165.[CrossRef]
Humphreys, D., Smith, B., King, L., West, S., Reeks, D., and Stephens, P. 1999. Efficient site specific removal of a C-terminal FLAG fusion from a Fab' using copper(II) ion catalysed protein cleavage. Protein Eng. 12: 179–184.
Humphreys, D., King, L., West, S., Chapman, A., Sehdev, M., Redden, M., Glover, D., and Smith, B. 2000. Improved efficiency of site-specific copper(II) ion-catalysed protein cleavage effected by mutagenesis of cleavage site. Protein Eng. 13: 201–206.
Jäntti, J., Keranen, S., Toikkanen, J., Kuismanen, E., Ehnholm, C., Soderlund, H., and Olkkonen, V. 1994. Membrane insertion and intracellular transport of yeast syntaxin Sso2p in mammalian cells. J. Cell Sci. 107: 3623–3633.[Abstract]
Jeon, J.W., Son, S.J., Yoo, C.E., Hong, I.S., and Suh, J. 2003. Toward protein-cleaving catalytic drugs: Artificial protease selective for myoglobin. Bioorg. Med. Chem. 11: 2901–2910.[CrossRef][Medline]
Jitsukawa, K., Mabuchi, T., Einaga, H., and Masuda, H. 2006. Site-specific recognition of dipeptides through non-covalent inter-ligand interactions for the hydrolysis of dipeptide to amino acid ligands mediated by ternary cobalt(III) complexes. Eur. J. Inorg. Chem. 2006: 4254–4263.[CrossRef]
Kim, K., Rhee, S., and Stadtman, E. 1985. Nonenzymatic cleavage of proteins by reactive oxygen species generated by dithiothreitol and iron. J. Biol. Chem. 260: 15394–15397.
Kumar, C.V., Buranaprapuk, A., Cho, A., and Chaudhari, A. 2000. Artificial metallopeptidases: Regioselective cleavage of lysozyme. Chem. Comm. doi: 10.1039/a907477e.
Nilsson, J., Stahl, S., Lundeberg, J., Uhlen, M., and Nygren, P.-A. 1997. Affinity fusion strategies for detection, purification, and immobilization of recombinant proteins. Protein Expr. Purif. 11: 1–16.[CrossRef][Medline]
Nord, K., Nilsson, J., Nilsson, B., Uhlen, M., and Nygren, P.-A. 1995. A combinatorial library of an -helical bacterial receptor domain. Protein Eng. 8: 601–608.
Oker-Blom, C., Orellana, A., and Keinanen, K. 1996. Highly efficient production of GFP and its derivatives in insect cells for visual in vitro applications. FEBS Lett. 389: 238–243.[CrossRef][Medline]
Platis, I.E., Ermacora, M.R., and Fox, R.O. 1993. Oxidative polypeptide cleavage mediated by EDTA-iron covalently linked to cysteine residues. Biochemistry 32: 12761–12767.[CrossRef][Medline]
Polzin, G.M. and Burstyn, J.N. 2001. Synthetic Cu(II) and Ni(II) peptidases. Met. Ions Biol. Syst. 38: 103–143.[Medline]
Pryor, K.D. and Leiting, B. 1997. High-level expression of soluble protein in Escherichia coli using a His6-tag and maltose-binding-protein double-affinity fusion system. Protein Expr. Purif. 10: 309–319.[CrossRef][Medline]
Rana, T. and Meares, C. 1991a. Transfer of oxygen from an artificial protease to peptide carbon during proteolysis. Proc. Natl. Acad. Sci. 88: 10578–10582.
Rana, T.M. and Meares, C.F. 1991b. Iron chelate mediated proteolysis: Protein structure dependence. J. Am. Chem. Soc. 113: 1859–1861.[CrossRef]
Sawyer, D.T., Sobkowiak, A., and Matsushita, T. 1996. Metal [MLx; M = Fe, Cu, Co, Mn]/hydroperoxide-induced activation of dioxygen for the oxygenation of hydrocarbons: Oxygenated Fenton chemistry. Acc. Chem. Res. 29: 409–416.[CrossRef]
Sobkowiak, A., Qui, A., Liu, X., Llobet, A., and Sawyer, D.T. 1993. Copper(I)/(tert-BuOOH)-induced activation of dioxygen for the ketonization of methylenic carbons. J. Am. Chem. Soc. 115: 609–614.[CrossRef]
Stubbe, J. and Kozarich, J.W. 1987. Mechanisms of bleomycin-induced DNA degradation. Chem. Rev. 87: 1107–1136.[CrossRef]
Tung, H.C. and Sawyer, D.T. 1990. Cobalt-induced activation of hydrogen peroxide for the direct ketonization of methylenic carbons [c-C6H12.fwdarw. c-C6H10(O)], the oxidation of alcohols and aldehydes, and the dioxygenation of aryl olefins and acetylenes. J. Am. Chem. Soc. 112: 8214–8215.[CrossRef]
Ueda, E.K.M., Gout, P.W., and Morganti, L. 2003. Current and prospective applications of metal ion-protein binding. J. Chromatogr. A. 988: 1–23.[CrossRef][Medline]
Walling, C. 1975. Fenton's reagent revisited. Acc. Chem. Res. 8: 125–131.[CrossRef]
Waugh, D.S. 2005. Making the most of affinity tags. Trends Biotechnol. 23: 316–320.[CrossRef][Medline]
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
| ||||||||||||||||||||||||||||||||
